Description :
From Genome Similarity Track
Location :
contig_17:720926- 723721
Sequence
2795 bases(100 bases per row)
GTACACCACACCCAGACGGCTAATAGTAGCGGGGGAAGCAGCACTTGTATCTGCTACTTCAAACAGCAACTGAATTTTTGGCAAGAGCTTGATTCGCTCA
CCATTGGCTAAACAGAGCGTCATGTTGTCATCCAGCACGGTATTCATACTCTCGATCCAGTGTACATCAATAGGGCCATCGAATGTTATCCAGTAAAATG
GGAGATTCCATGTTGATGGTTCACTGCTGACACCAATCGTTTGGTTAGCATAGTGGCGTGTTAGCATCTCCTCATTTTTCTCCATAATGCACGTACGCAG
CAACTTGGATGCGAGGCCGTCTGTCCACTCATGCGTTACAGGATGAAAAAATCCGTACAGCTCAACCATCGAAATCGACTTCGGGTTAAGAGTGTACGAA
ACCACGCGCTGAAACCGGACATCAGCGTGGGCTCTTCTTTCTCGCAGTGCAGTCACTGCGGACTTCAAAACCTGTAGTGCTGTACTCTTCCCACTGCCAG
TAGATCCGGTCTGAACAACACCGATGCGTACCTCTAAGGTCGCAAACAGTTGCAGCAACTTTTTTGTCCATTGACGAGGTCCTTGGAGATGACTTCGTCG
TAGCTGTTCATTGATTTCTTCCTCTAAAGCAATCATCCAGTTTGTAGCGCCAGGTGTAGGCGATGGGGAAAATACTCCAACTCCCTCGAGAATCGCACTA
CTTTCACTGGCGCCTATGGCTGAAAGGGTATCTGGGAAGAGATCTCTCAAAATTCCTTGAAACAACTGACTGTCATTGTCGGTGAGCTTTGGGGTGTTCG
CTCCGACCATGGCTTTAATCAAAATAACGTTTTCGTCACTGCAACTGTCAGGTGCCGATTCATGAGACGAGGTGGACTCTGGCGTAGGAGAAGAAACAAT
TGGTGTCGCTGAACGTTTAAGAGTGCCTGCCATCGTAAGAACTGTTCGTACAGCCCGCATACCGAAGTCGTAGTGAGGCTGCTGAGATAGTTGTTCACTA
CAAAGCTTATATAGCTTTGTTACTTTCTGGACAGCGGCTTTGCAAGCTGGAACCCTTCGGCAAATAGCAAGATTTCAGCGATCAAAGCATAATCCGGTAC
CATCATTGCGACTGGCCGGAACGATACTTTCAGGTTGTCAGGTAGCTCGGTGCGTCCAGCATAACCCGGGTTCATTGTAATTATTACGTGGTGGTCACGC
AAAGGAACACATTGGCCGTCTAGGAGCACCTCAGATAAGTTCATCAGGCGCGCGTTCCTTAGTCTCGACATTTGCTGCCCCACGACTGAAAGTACTTCAA
TGTCGATGCGGTTGAACTCGTCCAAGCATACCCAAGTTCCTGCTTGAATTACGCCATTAAAAATGCTCCCCATCATTTTGTAGCTCATCTGGTTGCTGCA
GTTAATCACAATACACCAAATGCCAAGCGCTTTCGCGAGGTCCTTCGATGTCTCAGTTTTTCCTGTTCCAGCAGGACCAGAAGGAGCTGCGCCGTAACGC
AGCTCAAGTGCTCCCGTGATCGTCATCCAGCATCGATCTGTTAGGGGGGTAATTACGAGGCGACTACACGCACCCATGTACTCGTATCCGTACTTGATTC
TACAGTTTGCTTGGAGAATCTCACACTCATCAGACTCGGTGTGCCATTGATATCGAAGCTGCTGCTGCCACAGAAGTCATTCGTCTGTAACGCGCTTCTC
CACCAAAGACTCGACAATATCGCGCAAGTGAACATCCGTCGTCACTAGAGACACAACTACGCGTCGCTGAACGGAGCTTAAAGATGTTCGCACTAGGCGA
GTCAAATTGCTTAACTGCGTGCAAATGGTCTGGTGCCAAAGAGATAGTTCTCGAATAGGATCTTGTGACCGTGAGCGAAAGCAAAACTCGCACTCTTTCG
CCCAAATTATGTAGATATCACTGCAACCGCTTGCGCGGGGTGACGAAAAATCCACGTCTCTCTTGAAGAATGCTGGTAGTCCGACAAACAGCTTTTGACA
TGTTTATGAAGGGTTGCCTTCATGTTGATGAGGACAGCGTTCAGCCAATCCTCAATATTACCGCGGGCTTTTAGTACTCGCCCAAATGTGACCCGCTCGC
CTTCCGGACTGATCATCGCAAGGATATCATGCGAGCTCAAACCCGATGCGGCTGTACCGGTATGCACTCCGTCATCATTTATATCTAGCTTTACTAAAGC
ATCAAAACACTTGGGTAAATGGCGCTGTACCACTTGAGGTTCCTTTGCATGTGCCAGCATTTCCAATAACTCATCATTTGAAATGAAGAAAAAGCGCGGG
AATGCCCGCCGCTTCATTTCAAGGTAGTCTTCTAAAGATTTTTCAATTCTTTCCAGTGACGCATTGTGCTTTGTCAGGCTGTCGAGCAGTGCCTGCCCGA
CACCACCAGTGCCACTGCTCCCAGTGCTACTGCTATTACCGTTGTCCTTGTAGTTTTTGGAACCACTGGACGCACCGATTAGTATAGCTCCCGTTACTTT
CAAGCAGCTTCGCTGATCTCGCGTTCTTCGCATCAAGTCTTTCCAGAACTGGTTAATGCCTAAGAAGGTAGTACCTTCATTAGGAAGTTGCTTCTGGATG
TCGGGTGCCGAGAAAATTGTCTCGAGATGCATCCATTTTCGTTGACATTCGATCCAAGCATCGAACGTTTCTTGAAACAGGAGCAATCTTTTGTGCCACA
TGACTGCTGTGTCTTTGATGGGGGCAATGAACTTAGAGCTCAACACCGCAGTCAAATTCACCAATGATTCTTCTAGTGTCGTGTAAATATTCTCG