Description :
From Genome Similarity Track
Location :
Scaffold_223:72082- 79808
Sequence
7726 bases(100 bases per row)
TATCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTCCGCTTTCTTTTGAATAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGA
GTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTACACTTGTAGTCAATCCACGCCACCGCGGGTAGA
CTACCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTT
CGGGATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCGTTCGACGCGTACGAGCAGGGCCTCATCGCGCAT
GTGCGGGAGATCCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGATTAAGCCGTATGAAGGGAAGGAAGGCAAGA
ACCTTCACTTCTGGGTCCGAGAGGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAGCTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGT
CCGTGCTAAGCGTTGGGTGTACACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTCCCG
GCGAACTACGAGTACCGCCAACGTTCGCGCTTCCTTTCGTGTAAACAAGGGAGGCGCGAGCTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGTGT
CCCTAGTGGGGAACCCACTCAGCGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTTTTCCGGGTGCAGTC
AAGCACGCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGGAGTTCCTTGTCG
GCTCCCGGTCGAGCAAGCCCCAACGGACCAGTTCCCATGGAGCTAGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGTCCACT
TCAAGCGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAA
CGCCGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGTGTGGCGCGTACCACGTAGACTTAGCCCCTGAGA
GTCTTCGCACTCTCGAATCTGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGATTC
TGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTTGCAACAGCAACAAGTTGTCCGATGCTTTGATAGAAAGCAAGGGCAACGGGACGGTGTCA
GTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGGAGACTTTGACAGCCTCGAACAGCTCACTGTTC
TCGATATGGATCCATATGATATGATCCTGGGTATGCCCTGGCTTGAGAAACACGAGCCCTGGATCGACTGGCGAGGCAACGCAATCGGTGCCAGCCGCCC
TGCGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGC
TTGGGAGTCGTCGACGGATATGACGACTCCGAGGATGTTTTGATGGTGGCAGCGCCCAGAAGAGGCGTTGGCCAAGTGGGTAACTTAGGTCCACAGGCGG
GTAGCTTAGTTCCGCAGACAGCTGCAGCTGTCACGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGCTCCACTCACGGTCGCCCAGACCTTAAC
TGAAGAGGACGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTCAAACACGCTTCC
TGTGTGGGTAACACAGTGCCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGAACACGCTTCATGTGTGGGTACCACGGTACCACACGAGGCCACGAGTGC
CTCGGATGTCGTAGCGCCGACATCCCTAGACGTGGGCAGCAAAGCTTCACGTCACGGTCGCCGTCGTCAACGACGCCGCCGCCGCCTCAAGTCGAATCCG
AACTTCGTTCAGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACGAGGCCGGTGGAAGAGTGTTGTCACATCTTCGATGGCG
AGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCT
GACCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACTCCTCCTCTGACTTGGACGAGAACCTC
CTGGAAGACCTGAACAAGCAGCGTCAGACGCGCTTGGGTTCTGAGATCCTTAAGAGCCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACG
TGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATGCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTT
GCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTC
ACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAG
TGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGG
CTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCG
ACGACATATTCGTCCATAGCCGTGCCGAAGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGCTGGACGTAATGCGAGCGAACAA
GCTCATCGTTAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTACTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCACACAAG
GTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGAGTACG
CGGGCTACGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAGGAGCACCAGGATGGTTTTGACAGCATCAAGGCCAGTCT
CCTAGAGGCCCCTGTCCTGGCCCTGCCAGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGCAGGCC
GACACGGCTGGACATGAGCGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAGCTACCCGGTCCACGACAAGGCGCTCCTGGCAATGA
AATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCA
CCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTTTGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTC
TCTCGGCGTCCTGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGC
CTATCGTCAAATTCCTTATGGCAGAAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGCTGAAGGATGGACT
CCTCTATTACCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAGCGACGAGGATCTGAAGTTCGGTATCCTCGCGGAGGCGCACGACGCGCCC
TCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTTAAGACAT
GCGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTT
CATCTTTGGGCTTCCCGCCGACGGACACGGCAGCACCAGAATTTTGGTGCTCGTGTGTCGGCTGAGCAAGATGTACCCTCTTGCTCCGGTTCCCGTCACC
GTCACAGGCGAACAAACCGCGAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAAACGAATGTTTCGGACCGAGACCCGCGGTTCACTG
CTGCGTTTTGGAAAACGCTGTTCCCTATACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAGACAGAGCGCGTCAATCG
AGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCAC
GCGTTCACGGGGCTCACGCCGTTCTACTTGAACGGCTTCCGTCACCCCAGAGTGCCTCTCACTCTCCAAGGAGCCACTGACTCCTCTATTCTAAGTGGGG
GAGAGGATCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAGCGTTGT
CAACAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTTAGACAAACATGGAAGAGGAAACTTAAGTATATTTTAAGGTGGGGGA
CTTAGTGTTGCTAGACACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGATCATTTGCAGTCCTG
GCCAGACATGGTGCGTCGTACACCATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGACCCGCAGG
GGGTTGCTGACTCGCAGACCCCCTTGATCCAGCTCCTCGAAGCGAGGGCCGGTCACAGACGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCG
GAACGGCAAGGCTGCGGTCAAGGCCGTACGCCGGAGGGGCTCCGTATGAACGGACCCCGGCGCCATACGCCGATTACGTCGGGTAGCACCATACGCGTAC
GACTAGGCGTGCGCCGAATGCGGATCCAGACGTGGCAGCAGAGCCTCGATACGTCAGATCATGCGGAAGGTCTCGTCAAGATCGGACGAAGAGGCCCGCC
GGGCCACCCGCAGATACAGTCTCGAGACCTCACGCTCCAGGCGGCCCGCAAGTCGATCGAGCTCGCCCTGATTCCCGGCCTGGGCGAAAGCATTTCCGCC
AGTCCCAAGGACAAGTGCAATCTCAAGCACGAGGACGCGTTGACGAAGGCGGTCAACCTCAGGGTCCTGCGTCGGACCCGCAGGAGAACCACTCGGACGA
GAGTAGCGTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTACCACGTGGAGCGGATC
CTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCGCACTCTGAGAACTTGTAGGAGCCGATTGAACGGCTTCTGA
TTGACTGCCGGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCTGCTTCATAAGTAGTCCGGGGGTTCTTGCCGGGTCTCGGGCTTCTTACGACAAGT
CGTGAAGTCCTTGAAAGGGATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAACGAACAACTGTTCTTTCTGAACAAGGGCACGT
TCGTAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACAAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAAT
ACCCTCTTGAGTTAATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAATTCCTCCTGCTGCTGGTCGAG
GTCATTCAATACCTCCCATGGCTCAACGATAGCACCCTCCTCCTCTTCTTCCTCATTCTCCTCCTCTTCATCCGAGGAGTCGAAGATACTCTGATAGGAG
TGTTAAGTCTCCTTCTATCGCGGAGTGGAGACTTAGAGGCTGTACGCCTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCACGCGCAAGACC
CTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCAGCTTTGGGAGTGCCCTTAGCCTTGACGGCCGGACTCTCAGAGCGCACAGAA
GTCCTGGGACTGTGATCGCCTTGATCACTAGCGAGCGACTGCACGCTGTCATCCTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAG
GAGCATCGTGCGTGCTCTCGAACTAGGCTTCGTCCTCACTGCCAGAGTTGAACTCACGTTCCACGAACCGAGGGTTCGGACGATTGTCTGAGGCCGAGGG
CGACGGACTGCGGCGCTTGCTTGCTCGCTTGCCCACATCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCCGAG
CCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCACTTTGCTGTGCCACGAGGCATCGCAA
CGGTCGAATTGGAGACCTAGACGAAGGGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGT
TTTCGACTTTGAGAATGAGAGTTTGTGTCGAACACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCC
CTAAGTGTACCCTGGTTGCATGAAGTGTGACACTTCACACTTCAGGTGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTCAA
AGCCAACCATTGGTCAAACGACATTGCATTTCTATAGGTAACTTATAGTTTGTATTAAACCCAAACTTTATCTACCTATAAATATACTCAGTTTACAATC
TACCTTATTTAGGTCACTCCGCTTTCTTTTGAATAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCTCAAGATAACTTCCTCTA
GCGCAAGGTGTGTGACCCCGTCACAT