Description :
From Genome Similarity Track
Location :
Scaffold_138:7208- 12602
Sequence
5394 bases(100 bases per row)
GTGTAAGCAAGTAACGGAGTAAATACCTGGGCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCAACGACCAAGTTCGACATGAGCCAAGACCTCGACCA
CGCTGCCTTTCTCCATCTCACTCGGATCGAGTGGGAAGCTCTCCACCGCCTTGCGGCGGTGTCCGGAGAAGCCGTCGTCACGTCGCTGCTGCGCTCAGCG
ACGCCCGACGAGCAGCGCGTTGCGGCACAAGAATTCATGGAACGCGAGCTCGCCGATGCGAATCGGCGAGTGTCAACTCCCTCGCGTATCTCCACGAATG
ACGTCGTGAAGCTAGAGACGTCCACCTACTCCGGTGCCGGAACAGATCGACTTCCGCTGAATCGCTGGTTTCGAGAGATCGACATCGCCATCGCCTCGAG
GTTGATCGAGGCGCCTTCCGCGAAGGTCCATTTCCTCCTCTCGAGGCTGTCTGGGAAAGCCAAGGAATGGGCTCTCGGCAAGTTGGTTGTCGATCCCAAC
GTCTTCCCCACTCTGGATACCCTCCAGAGTGACCTTCGGCTCGCGTTCGAGCCGCCGCAAGATGAATCCCGAATTCGGGCAGACTTCTTCGCCCTTCGGC
AAGGCACGATGACTATGCGCGACTACGTCCAGAAGACACGACACCTCGCGTCGTGCATCGTGTCTAAGCCGATCGATATGGCCTCTCAGGTTCATGTATT
CGTGTTCGGTATGCGCGAAGGCATGACGCGCTACTGCCTTACAAGATCGGACCCCTCTACGCTCGAAGAGGCATTCGCCCTCGCCCTACGCGAGGACTAC
GTGGTTGCGGCGTCATACGCTCACGCGCTACCTGCTTCTGCTCGGGATTCTGCGCCCGAGCCCATGGACATCGACGCTATCGATGCGACGAGCAATCGTC
AGCGTTATGCAGCGCGTCAGAGCGGTGCTCGGAACAATCGTTCTCTCACCTGCTTCCGCTGTCGGAAGGTCGGTCATCGCGCGGCGGAGTGCCGCGCGCC
AGCTCCAGTGCTTGCGCATGTCGATGCCGAGCCCGTGAGTTCTGACCAGCCAAAAAACGGTCAGGGTCAGTAGGTGCGGGGCGCCCTACTGGCTGGAATG
GAGGTCCGGGTCCCCCGGTGGCAACCCAACCTCCTAGCCCTCCTGTGCTGCATGCACACTTTCATGCCACCACCACGCCGAGCGATTCAAGATTGATCAT
TGTCAGTCTTCATGTCGCCGGTGCCCGGCGACCACTGCGAGCGCTCCTTGATTCAGGAGCGACCAACAACTTCTTCCGCGCGTCGTGCTTGTCGGTACTC
CCGTCGGACATCACTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCCACACCGCTGGCATCTAAAGGACCAGTTGCCATTTCCGTCTCCTCCAAAGTTCGTTCACGATAC
TCCAACACTGCGGCTGTGGCAAATGGATACAGACCATCACCGTCTTCTTTCGACGTTGCGTGTACCTTTGACATGCCGACAAGCTGGTCGCAAACACTCC
AGTCTACGAGACCGCCCGCGAATATGAAGATGTATTTCCGGATAAGATCCCAGCTGAGTTGCCAGCTGACCGAGGAATTCGCCACGAGATTGATCTCGTG
CCCGGCTCGAAGTATTGTGTGACGCGGCAGTGGCCGCTCCCGCGAGATCAGGTCCAAGCTATCGATGACTTCTTCGAGAGCCGCCGCAAGGCGGGTCATG
TGCGTGAGAGCACATCGCCGCACTCCAGTCCGACCTTCTGTGTGAAGAAAGCCACGGGCGGATGGCGCATCGTCCATGCCTTCAACAAGCTAAACGACGC
TACCATCCCTGCCCAGACGCCGATTCCGCGGAAGGACATGGTGCTCGACGCAATGTCGGGTAGTGAGGTCTTCAGCGCCATCGACTTGACCGATGGGTTC
TACCAAATCCTCATGAGGCTGAGCGATATACCGCTCACAGCGGTAAGAACTCCCAGTGGTATGCTCTGGGAGTGGCTTGTTATGCCGCAAGGGTTGAAGA
ATGCTCCCGCCACGTTCAATCGCATGGTATCCCATGTGCTGCGCCCGCTCCGCGACTTCGCACCGAGTTATTTCGATGACATCTTCGTACACAGTCGCGC
TGAGGGAGGCCTCAGCGCGCTTGAAGTTCACTTGAAGCATCTGAGGCAAGTCTTCCAAGTGATGCGCGAAAACAAGCTGTATGCCAACTTGAAGAAGTGT
ATATTCTGCGCGCCGGAGATTCCGGTGCTTGGCTGCTTTGTGAGCAAGAAAGGCGTCCGCGCCGACCCCGAGAAAGTGTCGTCGATATGTGCGTGGCCTA
CGCCACAGAATCCCACTGAACTGCGTCAGTGGCTGGGTCTCGCAAATTATCTCCACACGTACACGAAGAATTACGCCGGATTGATCCAGCCGCTCTCTTC
GTTGTTGAAGAAAGATGTGTCGTGGTCGTGGACTTCCGCACATCAAGCCGCCTTCGACTCGGTGAAGAAGAGTCTCGACGAGGCCCCAATCCTCGCGCTC
CCGGATGACTCGAGGCCTTTTCACGTCGTCTGCGACGCGAGCGATTTTGCCATCGGCTGTGGGCTGATGCAATTCGATGAAGAAGATCGAGAGCGTGTCG
TAAGCTACCATTCTAGGCAGATGAAGCCGGCGGAGCGCAACTACCCTGTTCACGACAAGGAGCTCCTTGCGGTGCGCTACGCTCTGATCTAGTTCAGAGT
GTACTTGTTGGGTGAGGATACCTTCGCGGTGTACACCGATCATGCATCGCTGAGGACAGCGATGAAGAGTCCTCATCTCTCCCAGCGGATGGCCCGCTGG
CTTTCGTTCTTCTCTGAGTACAACTTCGTTGTCCACTACAAACCCGGCAAGAACAACATTCTCGCCGACGCTTTGTCTCGGCGTCCCGACTACGACCCAC
GCGGTGCATTGGGTCGACAAGCTTCGCTGGATGAAGACGATGTAGACGAGTGTGCCATGTGCGAGGCGTCAGGCGTCAACCTGACGAGCGTCTCCCCGGT
AATGCCACTTCGCGACGAGATCCGAGCTGCTTACGAACATGACTCGACGTGCTCCAGTATCCTGAAGCATCTCCGCTCTCCCAGCGCCGACACACTGGGA
GCCCTTTCCCGCTCTGTACGAAACAAAATCCACCGATATCGTCTCGAGGACGAGCTGCTGGCGTACAGCATCGACAACTTCGATGCCCCACGTGTCGTTG
TCCCTAACGACCCCGATCTGCGCTCACGGATTATCCATGAGTTTCATGATGCCCCGCTGGGCGCTCATCTCGGTCGCGAGAAGACATTTGCCGCTGTGTC
ACGCGACTTTTATTGGCCACACCTGTACAAATGGGTGCGTAAGTGGGTGCGCACCTGCGAGACCTGCCAGCGCGTGAAACCTGCCTCGTCTTCGCAGGCT
CCCTTGCGTCCTCTACCAGTGGCCACCGAGGCCTGGCGCTCGGTGTCGATGGACTTCATCTTCGGGCTCCCACCCGATGCTAAAGGACGATCAGGTGTCT
TGGTATTCGTAGACCGCTTCAGCAAGATGGTTCACCTGATTCCGGTGTCGGATGCGATCACCGCGGCAGATACCGCGGTGCACTTCCTTGATGCCGTCTT
CCGTCATCATGGCCTTCCCGAATCTATCGTCTCCGACCGCGACCCGCGCTTCACGTCGGCCTTCTGGTCAAAGCTCTTTGAGCTACTGGGCTCGAAGCTA
ATGATGTCCACAGCAGCCCATCCGGAAACGGACGGCCAGACGGAGCGCGTAAATCGCGTCCTCGAAGACGTCCTTCGAAGCTACGCGACGTCGTTCTCCA
GCTGGAGCTCGTTTCTGCCACTGGCCGAGTTCGCTCTGAACAACGCGGTACACGCGTCGACTGGGCTGACGCCCTTCTTCGTTAACAACGCACGACACCC
GCGTGTCCCTGCTCTCCTCGCCGTGGGCCATCCCACAGCGCCGTGTGTCTCCACTCTGGGTGGGGAAGAAGCTGCCGACAAGCCGTCTACTCCATCTGCG
ATGTCTCCGGCGGCTACACCGGTACTGGGTCAACGTGTATATACACCGGTTGCTAATGATATCTCGAGTGTATCCCCTGTTCCCACGTCGGTCAACGCAG
TGACACGCTCCGCATCGAGCTCACTTGCGCCAGCTAACTACGCGCCGAAGCATGCGGCGCGACCAATCGACTCCGCAGTCGTCTCCGACTTCGTACTACA
GCGCCAAGCGGTCACCCGCTATGTTCGTGACGCACTGCAGGACGCAGTGGACAAGCAGAAGGAGAACGCTGATAAGGCTGGCCGCAAGAACACAGCCACG
TTTACGACAGGCGAACGAGTGCTCCTGTCGACTGAAGGTATCAGAAACTCTGCGGTTACCAACCTCGGCGCGAACAAACTCGCGTCGCGCTTTATTGGGC
CGTTTACGGTGATCAAGACCATTGGTGACGCTTACACTCTGGATATTCCTTCGACACTACGGCTACATCCGACGTTCTACGTCGGACGTTTAAA