Description :
From Genome Similarity Track
Location :
Scaffold_63:7208- 9086
Transcript NameFunction/comments
g7344.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
AGATACGAGCAGTGGCGTGCCCAGAGAAACTAAAGGAGATTGCGTACTTGGCGGTTGATGGCGTTGAGATTGTTGTGCATCACCATGAGGTGCACGTCAA
CTGGCCTTGCAGGAATTGCTTTTCACCGGACCATCCGACCAAATTTCGCAGGACGAACCAAGGAGAGGTGAAGATCAGGAGGGCTCATCACACATACAGT
ATCGAAGGACGGCTACCATCGAAGAAGGTATCACTAAACAAAGGATACGATGTGGGGAGCCACCCGACTACTTTGGAACAGCTGAACGTGCTGTTAAGAC
CTGACATCACCAAGCAAAGCAAAAGGGCGGAGAAAGAAAAGAAGGCGGTGGAGCAGAATGCCAAGGACCCACCTTGTAATGTGGATGTGCCAAAAGAGGA
GGGACCAGTGCTACCTGCGGAGTGGCAGCAGCACAAACCATTGCATGGCGAAGACAATAGCAAATGGAGTGCCACAATAGGCGATGGAGGGGCAGGGTCA
TAGCTGACAAGAAACTAAGCGAGGGGAGGGACACGGAGAGCCATGGCGGCGCAGAAGGGGAGCATCGACGGTCTGGACCGCATACTGTGAAGGCAAGACT
GAGGACATGGCTCCGGATATGGAGATGGGTGAGGGGACGGCCGAAGATAATGACTTGGTTGAACCAGAGGAGGATTGCGTTGGGGAACATCTGAAAGAGG
GCCCTACAGTGGACGAGCGACCCAGAGAAAGGTCGCCAACGCGGAAATGGGTGATCTCATCGCGACAACTAAGGTACAGCAAAGATGCCAACTCGACTGG
AGTAGGCAGTTTAAGATGGAAAGCTAGCGACAAGATCAACCCACAATGAGGTCAAGAGCAAGGGTACAGAGAACTCACCCAAACGCCGGTGGTCAAGCGC
CTAGCTTCATTGTCGCCCAAGAGACGTGCGCCAGAGGAATGGGACAGTGAGCGACCGGGGAGAAGCAAGGAGCAGAGAGGCAAATAGCTACAAAATGCTC
CAAGACGATGGAAGACCAAGTCGTTATCTCCACGTAGAACGACAATGGCAGACAAAGGGATCAAAGGGAGCCTGCGCCACCAGTTGTTTATGCACCAGTA
TCTGCATGAGGTGAGCGAAAGGAAGAAGACGGGCGAGGAGTTTAGTGCGATGAAGCCACAAACACACGCGGAATTTCACGAGGTAGCGGAACAGCACACA
GAAGTGGGGAAGGCGGTGAAAGCGCGGTGCGGGGGCGACCTGAGCGAGGACGGCAGTGATGACGGAAACGATGACATCAAGGTCATCAAGGTGACACCAG
TCACGGATGCAGAGGCACCACTGGAGGAGTGGTTGACGCTCATTGAAGGGCGGATAGTGGATGTGGCAGCCCAGACCAGTGTGGTTGGTTAGCATTCTAT
GCAGCACTTACGAATTTCAGCGAAGGACTGTTGACACCTGATGCAAAAATTGCGGGGGAGGCCAACAATCTCAAGAAGCAAGTCATCAATGGCATGTTGG
CCAACCTGGTGGATGAGAGTGGATTGCATCCAGTGGAATTGATGGTGGAATTGGACGTGATTGGAGTAAAGATCAAGGAGGTGGCCAACTGGGAAGAACA
AATTTACGCGTTAGCCAACCACTATGCGAAGCAGCGACAAAAGTCGGTGAAGGTGCTGGTTCCTCTGCACTATTGGGTGCGACCTGCGCACATCAAGGCG
ATGACAATGCACGCCAGAGAGACGTTGTATGTGTTGCATGTGGAGGCGAACGGCATGGCAAGGACTCAAGTCTATGCTTACCACAACGTGCGTATCTCAA
CAGACGACTACATTGAATCGGGTACAGTGGAGACAATGGACACCAGAGACGCGATGCAGCTTTTCAGGGCTCTGACCC