Description :
From Genome Similarity Track
Location :
Scaffold_392:7208- 8576
Transcript NameFunction/comments
Phymu_g9428hypothetical protein PHYSODRAFT_350658

Sequence
1368 bases(100 bases per row)
CgtaaaagctgctgctttggcGATTcggaagctctcgagcacGTGTTGAGGAGGGATTTCCAGGGTTATCTGACCAGTAACAGGATCCACAGCTTTCGCT
CGCTTAGCTGTTAATAAATAGTGATTCTGGTCGATGGAGACGCCCGAACCAAGGAACCGGATGACTTTCGTGAGTAAAACCGCCATATTTGCTTTTACGT
CGTTTTTCATGACACAAGCGCCGTCCGAGCTCACTTTTCGCCCGAAAAACTCGAGTTTCAGTCCCAATTGAGCACAAGCGACCGCGAATGAAGTCATTTT
GTCCTCCATGCCCTCCGTCGACTCTGTGATGGCCAAACTGTCCACCATCGTGTTGAGTTGGTGCAGGAGGTTGCTGTTCTTGAGGATTTTCGTGTCCAAT
TCCGCCTTGACACTGACAGTTGTACTGGAAGCCGTAGCAATCGcctcttgtgcttcttcgtcgcgtTGCTCGGCTGCCGAGAAGCGTGACACACTGTCCG
CTACTTCCTTGTCAAACTCGTTACGCAAAGTACTCGCTGTCTTGCGGTCGTCCTCGATCATAGTAGTGATATCTCGGATACTCTGGCGGTTCTTGGCGAT
ATTCGACGAATTAGTCGTCACGAGCGCGTGGATCTTGGGCagttcagcagcagttcgagctagtgccgtcgtcgtcgtatCCGCAACTTTACTCACTTCC
TGCAACTTCTGCTGGACTTCTTGAACCGCAAAGCCTAGATCCGAGACGTTGTGTTTAATTGCTGTACGTTCGACTGCTGCCTGGTTGAGATGCCCTTGTA
TGGCTGCTACAATCTGCTGTCGCTCCTGATAATGTTCCTGCAAGGCTCCGACTGTACTGGTGAGTTTCTTCTCCGTGAGAGCCACTCTACCGTCGATACT
ACCAAGTTTCGCGTCTGTAGCCCCCACCCGCTCTTCGTTGCGGATCAACTCGTCATTatggcgctggacgacgataTCCAGCGCCCGGATACCCGTTTGA
TGCGCTGTTAGAGTCGAATTACACGCTGTAAGATCCGACGCTAATGCGGCGAACGAATTCTCCGTCGATCCTACAAAAGCGTCGTACGCTTCAATATGTC
GCTGTACACTTGCTCCTGCGCTCGCTATCTGCTGGTAgatcacttcaacctggTTTTTAACCTTCCCATCCTGCTCGTCGAGACGCATTGAAGCTTGTGA
GCACATTCCATTGAGGTGTTCCAtgtccttctcctgttcagccagcagcttggcgtgCTGTTTAGTATCGTGGTCGAATCGCTCCGTTGAAGCCTTTATG
GACTCTACGAACGCGTTCATCTCTCTAGAACTTTCCTCCTGCGTGACCATCTCCGTCTGCAAGTACTG