Description :
From Genome Similarity Track
Location :
Scaffold_11:72068- 75657
Transcript NameFunction/comments
Hyaar_Emoy2802128hypothetical protein

Sequence
3589 bases(100 bases per row)
GCGGGGTAGAATTCGAGTGGGCATTTTGTACACAGGATGATCCACCAACGGCCCTGCATACTCTTCCACTGTCTCTTCCTCTCGTTCCGTAGTCGCTTCA
AACACTAGCGTTTGCCATTCTGTATACCGCCGTGACCCGATCGATACATACCCTGGTGATCTAGGGTATGGATCGATCGGGTTACGACGGTATCATGTCC
GATATTATCCACAAAACCAACGAAGCTCCATGATTTAAAATTGTTTCACGATCGCTGAGGTTCGTGAGCTGCAAATACTTGACTGGACGGGCCCACTAGT
GACTGTCGGCACCCACTCCACGTCTCGCCTCACCCAAAGCTTAGCCTTAGGTGGGCCAACCCCAATACGTACTTCTTTCGATCTGCCAACCGGTATTACC
ACATGTTGATCATTCAGGTTGATCGCCTGTATGGTCGATCGATAAGGTGGCTTGCGTCCTGCCAAAATTAATACGCACCTCGTCAGGTAGACAGAATGTT
CCGTCGGCTAAGTCCAAACAGACACCCGCCGGAACCATGAAATCCATACCCAATATGACTTCTTGGCCGACCTGATCATTTACCCAAATGTCGAAATAAT
AAACCAACGATCCGTCCAAAGTGATCCTGATCTTCGTCCGCCCCACCGTCATATACGTGTTCTCTCCAATTCCGACGCACTCTTGTGTTTGACTGTCGTC
GATCACACATCCTACCTTACGAGCAAAGGTAGTGTCGAGGATCGACACTTCAGCGCCGGAATCGAACAGCATCGTGGCTTTCTCATTGTTGATCGTTCCC
ACCGCTTTTGCTTGCTTGAACCATTTTCCGGGTGTGTGGTATTTCCAATACCCGCGCGATTCCCCTGGCGCGAGGTCGATCTCCATCCTCAAAGGTGATC
GGGCGTAATCATCCACTCTTTTTACACTTGATATTGACGAGACCAATGTGAAATCTTTATGTGTATTAGCGATCGGATCGATCCGATCGTTAACCTCTTG
ATCTCTCCGTGGTCCTTCCACAAATGCATAAATGAAAAGCCTAGAACGCTCGGCTCGTGCCAGATTCCAACCTGGTGAGCGTTCTAGTTTAACATCTCCT
CCACCTTGGGCGGAAACATTCCAGCATGCTTCGTAGGCACGTACCACTTTCGGACCAAATTGAAAAATTCTTCCATGGGACACTTGCCACTCTCGTGTAT
ATCCCCGCATGTTGCACACACGAAGAAACATTTTTCAGAGGGGTGTCCTTTGCAACAACATTTCTGGCACGTCAATCTCTTCCATCACCCTCGATAATCG
TGTCTGTTAGATCCACAATGCGTGCACGCCTTCGATCGTCCACTACGATCGCGTCCCTCCCCTTCACCAGTGTTCTTCTGCCAGGTGCGACGATCCTTGT
TCGGTTTTTCTTGGTCAGATGTAGTTGCTACACAAACACGATGACGATCTACGTCTTCCTCGGATCCAATCGACTCCGATTCTGATCCGCTGCTCTCAAC
TTTCTCGCGGATCGCTCGCACCGCCCGAGTCGTCTTGGACGCCATCGGATTTGCAGGTGCGATCGCTCGCTGATGGAATTTGTTTGATCCCATCGACGAT
TTCATCTGACGATTCTTCATCGGTTGACACGCACGAAGAGTTTCTTTCATCTCGTCAATATCCATCAATCGCAGTAAGGTCAGCTGTTTTGCCATATCGC
GATCGCCCAGCGTAGCAATGAAGTATTCCACGTGCTCGCGACGCGTGGCCAATGTAACCAGTCTTTTTTCTTTAATCGCGATCTTGGCATGCGTGGCCGC
GACATTAAGACGATGCAAGTACTCCAGCGGGGTTTCATCGGATCGCTTCCGTGAGAGGTAATACTGTCTGGCCTTTCCCTCCATACTGTATCATAAAACA
ATCCAGCAATCGTTTCCACTTGTGCCGTGTAGATCGGCTCAGTTGGTTGTACCAGTTTCGCACGGGTCTCGTCAACAGATCACCGAACACCAAAATCTTT
TCTTCATCTAGCGCCTAATCGCGCAGGAACGCCGACTTGACCTTGCTGATCCAGCTTCTGGCCCGATCTTCGTCTCGATCTTTGCCACTGAATTCCTTTA
GCTCTGTCATCGCTGACACTAGAACGCGTTGGGGAATACCACCACCGTTTTGCAACGTTTCTGTGATGGCTACCATCGCACGTCGCCGCTCTTCTTGTCC
CAAATTATCGGGATCAGCATCTTTGGGATCGAAAATGTCAGATCGGCTGTGATGCGATCGCACCGACTCCATCTCAACATCTGGGGTATATGTTTCTTGG
ACTCTTGCCGGCTTGATTCTTTGGCTTGGGTAGATCGCTTGATACGCTCGTTCCCGTTGAACTTGATGAAAACGTTCAGTGGCCTCATCGAGGTACGTCC
GCAGGTGTCCTTGCATAGTTGACGTCATCTCTCCTTTAGCGCATGTGATCATCGATGACGGTTCAATCTTGATCGTCTCAACTCGATCGCGTAGATGTGC
TGCCCCACTTGGGCCTAGAGGCGTCCGCTGAATACCAACCGAATCATCCGACTCCATTTCAGAATCAGCCGAGGTGTACTGCGACGATCCAGTATGGTAT
CCTCTCGGGACGTCGGCGATCGTAGTGGCAGTTTGATCTGTGGATTCGCGCTTACCCGTCAGGGGGGTCAACTTGTTAAATAGCGATCGACACGCGTGGA
TCAACTGATCTTGATAGCACTCCAGCAGTTTGTTCGCGTCGAACACTCCAGCAACGTATCCAGCGTCATGGAGTAGCTGGATGATCTCGTTGATCCCGTC
CAGCGGGTTAGTTGTCACCGTCGGTGGGAATATCGTACCTTGAATCTCTCCGACCAGCTTGGGCTTCAATATCTGGAGCACTGTATTGCGCGATAGCAGA
TTCTTGGCGCCTTCCAGTGATATCCCTGCGCCAATTGGTCCAACTGCCAGCCTTCCATCTTCATGTTATCGTTCACAAACTTGATCGGCCGATTGATCAA
TTTCACACTGCGATCGTGTTGATCCAATCTGGGTTCTTCTTTCTTCACTCAATCTGTATTCACAATCTTCTTCTTCGACATTGCCTGAGTGGTCTTGTGT
AGTTTTTGTTCAGTTTTCGCTAAAGGGTTTTCACCCAGCGGATCGTGCTTTGCAGCACGATCCGCGGTGGTCCCCGAAAAGACCTCAGAAGGGGTTCGAA
GCTCTCTTCCAGATCGATTGATTGATCTTGCTCTTTGATCTTCTTGTCATCAGAGCCCCTCCATAAACCCTGACGATCTGGGGATCTTTATAAAATCACG
CGTCTACGGCGATCCCTCTGCCTCATACGCTTCCATTCCAGGTTCAACCTTGACCTTCTCATCTTCACTCAGGGACTCACGGTGAAATCCCGAGTCACCA
GATGATCCGGGCACGCGTTCCATTGTGGTGCAGCGGCGATCGCTCACTTTATGAGACGATCCCGACTCTCCACTGGTGCCCAGACGACCAACTATCGGAG
GGGGTACTCCGTTTCCGTGACTTGTATTTCCTTCCTCACCTTGTGTACCCGTCGGTAGGGTGGGCTGCACTCTTCTCGGTGGACTCGTG