Description :
From Genome Similarity Track
Location :
Scaffold_129:72068- 73568
Transcript NameFunction/comments
g12507.t1hypothetical protein

Sequence
1500 bases(100 bases per row)
GCTACGTGACTATCAGCTTACAGGTGTGAACTGGATGTTGTTTAACTGGTACCAGAAACGTAACTCCATGCTTGCAGACGAAATGGGTCTCGGTAAGACG
GTGCAGACCGTAATGTACATCAATCATCTCGCTGTAGTGGAGCGTACACCGCAGCCATTCATCATTGTGGCACCGCTCTCAACCCTTGGCCACTGGCAGC
GTGAGTTTGACAGCTGGACCAACCTCAATGCTGTCGTCTATCATGGATCGGCTGCTGCGCGAGATGTTTTACAAAACTATGAGTTTTTCATGTCAGAAGA
TGAGCTACTACGTGCTGATGAACTTTCCGGGAAGAAACCCAATAACAGCACTGACAAGCGCTCGTACCCGCGACCTAAGCGCAACTGCTATCGCTTTGAC
GTGTTGATCACCACGTATGAGATGGCCTCTGCTACAGACCTGTACAAGCTGGCTCAAATTAATTGGCAACTGATGGTCGTGGATGAAGCTCATCGCTTGA
AGAACCGGAATTCCAAACTATCAAATATCCTGCACACAAGGTTTAAGTTTGAAAACATGCTGTTGCTGACGGGCACACCGCTTCAAAATAACGTAGAAGA
ATTGTGGGTGCTCCTCAACTTTCTCGACCAGAAGAAGTTTGAGTCGAAGGAGAATTTTCTTGAAAGCTTTGGCGAACTGACAGATTCAGCGCAGGTTGAG
AAGTTGCATTCAGAGTTAAAACCGTACCTGCTTCGACGAATGAAGGAGGATGTGGAGAAGTCACTTGCACCGAAGGAAGAGACTATTGTCGAGGTGGAGC
TTACTGTACTGCAAAAACAGTACTACCGCGCTATTTACGAGAAGAACACAGAATTCCTTTCAAGGGGTGGAAGGAAGGGCGAGACCCCAAGCCTGATGAA
TGTTCTCATGGAGCTTCGCAAATGCTGCAACCACCCTTTCCTCGTCAAAGGTGTGGAGGAGCGCGAGGTGAAACGGCTGCTCAAGCAGACTTCTGTACCG
AAAGAAGAGATTCAACGTCAAGTCAGCGATAGCCTTGTGAACACATCGGGCAAGCTAGTTTTGCTGGACAAACTGCTCCCTCGCTTGAAGGAAACAGGTC
ACCGTGTGCTGATTTTCTCGCAGTTCAAGATTATGCTGGACATCCTTCAGGATTATTTGGCATTACGACGATACATTTGCGAGCGTATCGACGGAAACAT
TACTGGCAATGAGAGGCAATCGGCGATCGATCGTTTTTGCCGAAAGGACAGTAATTCGTTCATCATGCTGCTGAGTACCCGTGCTGGTGGTGTGGGTATC
AATCTGACTGCGGCCGACACTGTGATTATTTATGACAGCGACTGGAACCCGCAAAATGATCTTCAGGCGCAGGCGCGCTGTCATCGTATTGGCCAAAAGA
AAAGCGTGAAGATTTATCGTCTGCTCACGTCAAAGACGTACGAGCTGCACATGTTTCACAAGGCTTCATTGAAACTGGGACTTGATCAAGCAGTGTTGGG