Description :
From Genome Similarity Track
Location :
contig_93:72059- 74249
Transcript NameFunction/comments
g12695.t1hypothetical protein

Sequence
2190 bases(100 bases per row)
AGAAGATGGAAATCGAGCAGTGCGCGAAGCTGCTGGGTGTGGAAGTGACCGCGTTGAGCAAGCAGCTCTGCAGCCGTACCGTCAAGGCGCGCCAGGAGGT
GTACTGCGTCCCGCTGTCAGCTCTGCATGCCGGCAACAATCGTGACGCTTTAGCGAAGGAGATCTATGCGCGAGTATTTGGCTACTTGGTGCGACGCGTG
AACCACAGTATCTCGAACTCGGCGGACAGAGGCGCTTCGACGCCGTCATACTTGCATATCGACCTGCTGGATATCTTCGGCTTCGAGTCGTTCGAACACA
ACAGCTTCGAGCAGTTCTGCATTAACTTTGCGAACGAAAAACTGCAGCAGAAGTTCACGATGGATGTGTTTAAGACGGTTCAGGAGGAGTACCAGCAAGA
GGGCGTTGCCTGGGAATTCGTGAAGTACCGCGACAACCAAGACATGTTGGATCTACTGGAGAACTCGATGGGCGTGATGGCACTGCTGAACGAAGAATGT
GTGCGCCCCATGGGAAGTGATTTGTCATTTGTATCGAAGCTTGTGTCACTGCGCGAGTCACATCCACGTCTTGAGCGAGCACGCCTCAGTCAGACGCACT
TCATGCTGCACCACTATGCGGGCCCCGTGACATACGACGCGGAAGGCTTTGTCGAGAAGAACAAGGACTCGTTGCAGACTGATCTACTGGAGCTGCTTGG
TACGAGCTCAAATGGCTTGCTGTCGATGGTATTCGGCGACGACAACAACACAGCATTCATGACAGACGCGGATCTGGCTGTCCGTGCGGCAACCATGATG
GAGTCGGGACGACGCAGTACTGTCGGACGGAAAACGTCAACCTTCATGCAAGAGACCGTGAGCTACAAATTCAAAGCACAGTTGTCGCTGTTGATGAGTG
ACATTTCCAGCACTGAGGTGCACTATGTACGTTGCATTAAACCCAACTCGCAAAAGAGCCCGAGTGTCTACGAGATCGATGCGGTTGTGAACCAGCTTCG
CTGCGCCGGTGTCGTTGAGGCCATCCGTATCACACGCGCCGCATTCCCCAACAAGATGGCTCACGAAAAGTTCTTGCGCCGATTTGTGATGATGCGAAGC
AAGAAGGGTGCTACTATCGCTGCAGCATCCACAACTGTCACTGAGGCTTGCGAACAGCTTGCGAAGGAACTACTTAGTGGAGATGACTTTGCCCGAACGC
AAGACGGCAGTGAACACTCCAGGACACCAACGTTCGTGGTAGGTAAGAGCCTGGTCTACTTCGGCAAGGACGTGCTTGAGTTCCTGGAGCACAGGCGCAC
CACTTTCGTGCATGACCAAGCAATTGTGATCCAGCAGACTGCGCGCCGGTGGATGGCGAGACGAAAGATTAAGAAGGTCCGCACAATGATCGCAAAAGTT
CAGGCCCTTCAACGCTGCCGGATACAGCGCCGATCATACTTGGAGAAGCGCAGGAAGTGCACCATTGTGCAAAGTGTGTGGCGTGGAGTGCGCTCGCGTC
AGCGTGTGTATTTGATGATGAAGGAGAAGAGCGCGATCAAGGTCCAAACTGCGTACCGTCAGTATCTCGCGGAAAAGAAGTATGCAAAGTTCCGGAATGC
TGTCATCAAAATGCAAAGCACTCTTAAGATGAAGAAGCAAGTGGGCAAGTACCACAAACTTCTGTCTGAACGAAAAGAGCAGGATGCAATGGAGACCGAG
GTAGAGCTTCTCAAGCACCGTCTTGAGGACGAGAAACGCGCGCGCATGGAGATCGAAGCGGAGAACTCGTCGCTGCAGCAAGAGCTAAACCAGGTTCGGA
ATTCCTCTGTGCCTAGTGCGGACAGCAGCATCTATGATACCGACGCGCCCCCGGTGTACCGGAACAGTATGCGATCGAGCAGGATAGAGCGCGAGTCCAT
GGACGACAGCAAGCTGCTCGACGACTCTGAGCGCATGATTGACTACCTGCGCAAGGAGGTGACGAAGGGCCGTGAACTCATTCAGCTGCTGTCCCAGGAA
AATGAAAACCTGAAGTCTGAAAACAAGAAGATCAAGGATGCCTACACGGCTGCTGGTGCATCGTTCGCCGCGCTTAACCAGCACAATAAGCAGCAGTCGA
AGGCCAACCTGCGTCTCATGAGCACCCACGCTGCGCTAATCAAGTCTCAGGAGGAGAAGATGAAGAAGTACAAGAAACAGGTGGCAGAAT