Description :
From Genome Similarity Track
Location :
contig_93:72056- 74246
Transcript NameFunction/comments
g13213.t1hypothetical protein

Sequence
2190 bases(100 bases per row)
AAATCGAGCAGTGCGCGAAGCTGCTGGGTGTGGAAGTGACCGCGTTGAGCAAGCAGCTCTGCAGCCGTACCGTCAAGGCGCGCCAGGAGGTGTACTGCGT
CCCGCTGTCAGCTCTGCATGCCGGCAACAATCGTGACGCTTTAGCGAAGGAGATCTATGCGCGAGTATTTGGCTACTTGGTGCGACGCGTGAACCACAGT
ATCTCGAACTCGGCGGACAGAGGCGCTTCGACGCCGTCATACTTGCATATCGACCTGCTGGATATCTTCGGCTTCGAGTCGTTCGAACACAACAGCTTCG
AGCAGTTCTGCATTAACTTTGCGAACGAAAAACTGCAGCAGAAGTTCACGATGGATGTGTTTAAGACGGTTCAGGAGGAGTACCAGCAAGAGGGCGTTGC
CTGGGAATTCGTGAAGTACCGCGACAACCAAGACATGTTGGATCTACTGGAGAACTCGATGGGCGTGATGGCACTGCTGAACGAAGAATGTGTGCGCCCC
ATGGGAAGTGATTTGTCATTTGTATCGAAGCTTGTGTCACTGCGCGAGTCACATCCACGTCTTGAGCGAGCACGCCTCAGTCAGACGCACTTCATGCTGC
ACCACTATGCGGGCCCCGTGACATACGACGCGGAAGGCTTTGTCGAGAAGAACAAGGACTCGTTGCAGACTGATCTACTGGAGCTGCTTGGTACGAGCTC
AAATGGCTTGCTGTCGATGGTATTCGGCGACGACAACAACACAGCATTCATGACAGACGCGGATCTGGCTGTCCGTGCGGCAACCATGATGGAGTCGGGA
CGACGCAGTACTGTCGGACGGAAAACGTCAACCTTCATGCAAGAGACCGTGAGCTACAAATTCAAAGCACAGTTGTCGCTGTTGATGAGTGACATTTCCA
GCACTGAGGTGCACTATGTACGTTGCATTAAACCCAACTCGCAAAAGAGCCCGAGTGTCTACGAGATCGATGCGGTTGTGAACCAGCTTCGCTGCGCCGG
TGTCGTTGAGGCCATCCGTATCACACGCGCCGCATTCCCCAACAAGATGGCTCACGAAAAGTTCTTGCGCCGATTTGTGATGATGCGAAGCAAGAAGGGT
GCTACTATCGCTGCAGCATCCACAACTGTCACTGAGGCTTGCGAACAGCTTGCGAAGGAACTACTTAGTGGAGATGACTTTGCCCGAACGCAAGACGGCA
GTGAACACTCCAGGACACCAACGTTCGTGGTAGGTAAGAGCCTGGTCTACTTCGGCAAGGACGTGCTTGAGTTCCTGGAGCACAGGCGCACCACTTTCGT
GCATGACCAAGCAATTGTGATCCAGCAGACTGCGCGCCGGTGGATGGCGAGACGAAAGATTAAGAAGGTCCGCACTATGATCGCAAAAGTTCAGGCCCTT
CAACGCTGCCGGATGCAGCGCCGATCATACTTGGAGAAGCGCAGGAAGTGCACCATTGTGCAAAGTGTGTGGCGTGGAGTGCGCTCGCGTCAGCGTGTGT
ATTTGATGATGAAGGAGAAGAGCGCGATCAAGGTCCAAACTGCGTACCGTCAGTATCTCGCGGAAAAGAAGTATGCAAAGTTCCGGAATGCTGTCATCAA
AATGCAAAGCACTCTTAAGATGAAGAAGCAAGTGGGCAAGTACCACAAACTTCTGTCTGAACGAAAAGAGCAGGATGCAATGGAGACCGAGGTAGAGCTT
CTCAAGCACCGTCTTGAGGACGAGAAACGCGCGCGCATGGAGATCGAAGCGGAGAACTCGTCGCTGCAGCAAGAGCTAAACCAGGTTCGGAATTCCTCTG
TGCCTAGTGCGGACAGCAGCATCTATGATACCGACGCGCCCCCGGTGTACCGGAACAGTATGCGATCGAGCAGGATAGAGCGCGAGTCCATGGACGACAG
CAAGCTGCTCGACGACTCTGAGCGCATGATTGACTACCTGCGCAAGGAGGTGACGAAGGGCCGTGAACTCATTCAGCTGCTGTCCCAGGAAAATGAAAAC
CTGAAGTCTGAAAACAAGAAGATCAAGGATGCCTACACGGCTGCTGGTGCATCGTTCGCCGCGCTTAACCAGCACAATAAGCAGCAGTCGAAGGCCAACC
TGCGTCTCATGAGCACCCACGCTGCGCTAATCAAGTCTCAGGAGGAGAAGATGAAGAAGTACAAGAAACAGGTGGCAGAATTGAAGGAGG