Description :
From Genome Similarity Track
Location :
Scaffold_119:72043- 73262
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_12985Hypothetical protein

Sequence
1219 bases(100 bases per row)
CCAATCGCATGCGCCCGCGACAACACAGTGCAACGGATGCAGCAAAACCGGCGCAAGGTCGGCGACGGGCTCGAGGTCGAGGCTGGCAGCGCCAGCGAGG
ACGGACCGCTACGACCGGCGATGGCGTCGGCCATGCTGCCCGTCGTCTACCTCTCGACCGAGGCCAAGGACAAGGAGTGGGCGACTAAGCTCTGGCGGCA
CGTTCGCCATTCGGTGCTCTTTGCGTGCACCGCAGAGTGCGTGACAACGTGCTTCGTCCCAGTGTGGGCCCACGAGACGACGGGCATCAACGTCAGCGCG
ACGCTCCTCAACATCGTTGGACCCTTCCTCGAAGGCTGTGCGTACACGCTCCAGAACGCGACGGCGCAAGACGAGTGGAAGCGCGCTTGCCGCTACTTTC
GCACCGTCTTCCTCGGGTATGGCTCGTCCGTGCGCGCGATTCACGTAGCTTCGCATTAGGGTCTTCACATCCTACTGCTACATGGTCGACCACGCCGGCG
ACCTCGTCGCGCGCAGTGCGTTCCTCGGCCCGCTTTACATCATCTCAACCATGTGCTATGCATCCATCGCATTCCTTGTCGGGCAGCGGCTCATGCACTA
TTGCATCCATGCGCGCAAGTTTCCGCGCCATCTCCCGCCGGTGCAGTACCTCTGGAACAGCCTCTCGCTCTTCATCGGCATCGTGCTCGTCGTCGCCGTC
CTCGGCCCTAGCGGCTTTGTTCGGTACTACATGCTGCCTCCTCGTTGGGTTTACCTCGCCGTAGCGATCCGAAAGACGCGCATTTTCTTGGAAGTTTTCA
AGTCAACGAGACGCTCGAGCTCGTGGTCGGTATGCTCATGTCGTGCCTGGGCATCTTCGCGTCCATGTACGTGGGCCATGGCAGGTACGACGGCCTTGTC
GACTGGGGTGCGTGGCGCTGCAACCTCGCCAGTGTCCTCTTCCTCGTGCTGGCGTACGGTACGAGCTACTTTGTACCGAGCGCGGTTCAGAACGTCGTCG
TCGCCAAGTTTGTCTCGTCGTTCTGCGGCTCGCTCTCGTGCTTCTCGACCGCGATCACGTCGACGATGGTAGCAAGTCGTCGTCGACCCCAATTGATGTT
GCCTAGATTTTGGTCGAGTCGAAAAAAAGCCCATGGCCGCACTGAGCTTTGGCGTCTCGGCCGTCACAGCCCTCGTCTTTGTACCGTATTTAAGAAAGTA
ACAAGACTCGCCACCATGG