Description :
From Genome Similarity Track
Location :
contig_85:72042- 73394
Transcript NameFunction/comments
g10441.t1hypothetical protein PHYSODRAFT_340450

Sequence
1352 bases(100 bases per row)
CATGACGGTCAAGCCCTACGGCCCGGCTGTGACCTGGCCATGGCGCTCAACTACGTGATCGGCACGGGCTGCTTCGGACTGCCCTACGCCTTCATGGAGG
CCGGCATCGGACTCAGCCTCACGCTCATGATTGTCGGCGTCATCGGCTCGCTCATCACCATGAACTACACGCTAGAGTCGCTGGCCAGGGCCGAGGGCGT
CTGCGCGGCCACGGGAGGAGGCGCCCCTCGCCACCAGATCACATACCGCAAGTTCGAGTTCGCCACGATCGCCGACATGTTCGGGGCGTGTGGGCAAGGC
CGCGGTGCAGCTGGTCATGGGCCTGTATTGCATCGGCTCGCTCTGGTCGTACGCATCCGTGTTCTCGTCGTCCACGGCCTCGCTCTTCTTCTCGTACGTG
CTGGGCGATTCGTGCGACGTGTACGGGGATTCGCCCTCGTCCGGCTGCCTGGAGGGCTACTACGTGTTCATGGCCATCTTCTCCGCCATTGTGCTGTCCA
TGGTGCTCATGGACATCAGCGACCAGGCGCTCGTGCAGAAGTTCCTGTCCGTGTACCGGATCGTGGCCTTCGTGCTCATGCTCGTGACGATGCTGGTCAA
GGTGGCGAGCGACGGACAGGACATTGTGGCCTCACGATACAATGCAATCGGCCTGGTGAACTGGGGGAACTTTGGCAAGGGCTTTGGACCCACACTACTG
GCGCTCAACTGCCAGTACAACATGCCGGACGCGCTGCAGCCGCTGAATCCCAAGTCCAAGGCGCGTTTCGTGGCGTTTGCTGCGCTATTGATCGCTGGTA
CGTGCTACCTTCTGGTCGGCCTGCTCGGGGCGCTGTCCTTCGACAAGATCAACCCGCTGGCGACGCTCATGTGGAGCGATTACACGGGCTGCGGCAACGG
ATGGGAGCAGTGCGGCCACGCCAACCCGGGCGGAATCGTCGTGCAGCTCGTTATCCTGCTCTTCCCCGTCATCAATGTGGTGTCGGCGTATCCGATGGTG
GGCGTCACTGTCGGCGACAACATGCTCATGTCGTTCCCGTCGCACCTCACTGCTCGCTTTGGTGAGGGGATCACACGCAGCATGTGCCGACTGTCGGTGG
CGGTGCCGCCGATTCTGTTCGCTATCGTGTTCAAGCGCCTGGACTTCATCTTCGCGGTTGCAGGACTGTTCGGATTCCTGCTCGGGTTGACGATTCCGTG
CTGGTTCCAGGTCATCGGTAGTCGCTACTGCCAGCGCGTGTGGGGGTTCCCTGGCGCCGCCATCACCGAGTTCACAGAGCCGATTGTGAGCTCCGTCCCG
TTTGCGAGTGTCTTCCTGGCCCTCACCTTCGTCATTACTGCAGTCGCCATTG