Description :
From Genome Similarity Track
Location :
contig_17:720350- 723143
Transcript NameFunction/comments
g4135.t1hypothetical protein

Sequence
2793 bases(100 bases per row)
GTACACCACACCCAGACGGCTATAGTAGCGGGGGAAGCAGCACTTGTATCTGCTACTTCAAACAGCAACTGAATTTTTGGCAAGAGCTTGATTCGCTCAC
CATTGGCTAAACAGAGCGTCATGTTGTCATCCAGCACGGTATTCATACTCTCGATCCAGTGTACATCAATAGGGCCATCGAATGTTATCCAGTAAAATGG
GAGATTCCATGTTGATGGTTCACTGCTGACACCAATCGTTTGGTTAGCATAGTGGCGTGTTAGCATCTCCTCATTTTTCTCCATAATGCACGTACGCAGC
AACTTGGATGCGAGGCCGTCTGTCCACTCATGCGTTACAGGATGAAAAAATCCGTACAGCTCAACCATCGAAATCGACTTCGGGTTAAGAGTGTACGAAA
CCACGCGCTGAAACCGGACATCAGCGTGGGCTCTTCTTTCTCGCAGTGCAGTCACTGCGGACTTCAAAACCTGTAGTGCTGTACTCTTCCCACTGCCAGT
AGATCCGGTCTGAACAACACCGATGCGTACCTCTAAGGTCGCAAACAGTTGCAGCAACTTTTTTGTCCATTGACGAGGTCCTTGGAGATGACTTCGTCGT
AGCTGTTCATTGATTTCTTCCTCTAAAGCAATCATCCAGTTTGTAGCGCCAGGTGTAGGCGATGGGGAAAATACTCCAACTCCCTCGAGAATCGCACTAC
TTTCACTGGCGCCTATGGCTGAAAGGGTATCTGGGAAGAGATCTCTCAAAATTCCTTGAAACAACTGACTGTCATTGTCGGTGAGCTTTGGGGTGTTCGC
TCCGACCATGGCTTTAATCAAAATAACGTTTTCGTCACTGCAACTGTCAGGTGCCGATTCATGAGACGAGGTGGACTCTGGCGTAGGAGAAGAAACAATT
GGTGTCGCTGAACGTTTAAGAGTGCCTGCCATCGTAAGAACTGTTCGTACAGCCCGCATACCGAAGTCGTAGTGAGGCTGCTGAGATAGTTGTTCACTAC
AAAGCTTATATAGCTTTGTTACTTTCTGGACAGCGGCTTTGCAAGCTGGAACCCTTCGGCAAATAGCAAGATTTCAGCGATCAAAGCATAATCCGGTACC
ATCATTGCGACTGGCCGGAACGATACTTTCAGGTTGTCAGGTAGCTCGGTGCGTCCAGCATAACCCGGGTTCATTGTAATTATTACGTGGTGGTCACGCA
AAGGAACACATTGGCCGTCTAGGAGCACCTCAGATAAGTTCATCAGGCGCGCGTTCCTTAGTCTCGACATTTGCTGCCCCACGACTGAAAGTACTTCAAT
GTCGATGCGGTTGAACTCGTCCAAGCATACCCAAGTTCCTGCTTGAATTACGCCATTAAAAATGCTCCCCATCATTTTGTAGCTCATCTGGTTGCTGCAG
TTAATCACAATACACCAAATGCCAAGCGCTTTCGCGAGGTCCTTCGATGTCTCAGTTTTTCCTGTTCCAGCAGGACCAGAAGGAGCTGCGCCGTAACGCA
GCTCAAGTGCTCCCGTGATCGTCATCCAGCATCGATCTGTTAGGGGGTAATTACGAGGCGACTACACGCACCCATGTACTCGTATCCGTACTTGATTCTA
CAGTTTGCTTGGAGAATCTCACACTCATCAGACTCGGTGTGCCATTGATATCGAAGCTGCTGCTGCCACAGAAGTCATTCGTCTGTAACGCGCTTCTCCA
CCAAAGACTCGACAATATCGCGCAAGTGAACATCCGTCGTCACTAGAGACACAACTACGCGTCGCTGAACGGAGCTTAAAGATGTTCGCACTAGGCGAGT
CAAATTGCTTAACTGCGTGCAAATGGTCTGGTGCCAAAGAGATAGTTCTCGAATAGGATCTTGTGACCGTGAGCGAAAGCAAAACTCGCACTCTTTCGCC
CAAATTATGTAGATATCACTGCAACCGCTTGCGCGGGGTGACGAAAAATCCACGTCTCTCTTGAAGAATGCTGGTAGTCCGACAAACAGCTTTTGACATG
TTTATGAAGGGTTGCCTTCATGTTGATGAGGACAGCGTTCAGCCAATCCTCAATATTACCGCGGGCTTTTAGTACTCGCCCAAATGTGACCCGCTCGCCT
TCCGGACTGATCATCGCAAGGATATCATGCGAGCTCAAACCCGATGCGGCTGTACCGGTATGCACTCCGTCATCATTTATATCTAGCTTTACTAAAGCAT
CAAAACACTTGGGTAAATGGCGCTGTACCACTTGAGGTTCCTTTGCATGTGCCAGCATTTCCAATAACTCATCATTTGAAATGAAGAAAAAGCGCGGGAA
TGCCCGCCGCTTCATTTCAAGGTAGTCTTCTAAAGATTTTTCAATTCTTTCCAGACGCATTGTGCTTTGTCAGGCTGTCGAGCAGTGCCTGCCCGACACC
ACCAGTGCCACTGCTCCCAGTGCTACTGCTATTACCGTTGTCCTTGTAGTTTTTGGAACCACTGGACGCACCGATTAGTATAGCTCCCGTTACTTTCAAG
CAGCTTCGCTGATCTCGCGTTCTTCGCATCAAGTCTTTCCAGAACTGGTTAATGCCTAAGAAGGTAGTACCTTCATTAGGAAGTTGCTTCTGGATGTCGG
GTGCCGAGAAAATTGTCTCGAGATGCATCCATTTTCGTTGACATTCGATCCAAGCATCGAACGTTTCTTGAAACAGGAGCAATCTTTTGTGCCACATGAC
TGCTGTGTCTTTGATGGGGGCAATGAACTTAGAGCTCAACACCGCAGTCAAATTCACCAATGATTCTTCTAGTGTCGTGTAAATATTCTCGAG