Description :
From Genome Similarity Track
Location :
contig_29:72028- 74044
Transcript NameFunction/comments
g5708.t1hypothetical protein PHYSODRAFT_325631

Sequence
2016 bases(100 bases per row)
GTCCAGCTCTCAAGCCCGTCGCCATGCGTAGCGTACCTCCCCGCGTGTCTCGCGGCGCCACCACCGCTGCCAACGCCGTCGCCGCGGCGTCCGCGCGGCT
CTCCATGACCGCCGACTCCACCAAGGCGCTGTGGGACGGATTCTTCCGGGGCGCCGAGAAGATTGCGCGGATCTCCACGCCCGAGCCGCACAAGCCGGTA
GCAGTCGCCTCTGAGCGCACGCCACTGCTGCTGTTCGACGCTACGGTTGTGCCCAGCAACGGCATCAAAGACGAGGAAGCGTCGATCACGCGGTGCATCA
AGAGACGCCACAGCAGTGAGGGCCAAGCTCTGCTGCGTCTGGCCTTCCAGATGCTGCTGTTCGCCGTCGTGGACTTTGCGCCCAACTTCCTCAGCGGCGT
GCTCACGGGCCACCTCAGCGCCGCGCACAGCAGCGAGTTCATGGCGGCGCGCAGTCTGGCGCTCATCTTCAACATGGTCACGAGCACGACGCTGGTCGCC
GCCATGAGCGCCGCCATGGACACGCTATGTGCCCAGGCCTACGGTGCCGGCCAGCTACGAGAGCTGGGGCTCTTCTTCCAACGGGGTTGCTGGTCTTCGC
CATTGGGTTCCCACCGGTGGCGCTTGCCAGCTTTACTGCGTCGAGCTGCTCGAGTTTGCAGGTCAGAGACGCGAACTCGCCCAGTTGGTTCACAGCCTCG
TGCTGCTGGCACTGCCTGGGGTGCCCTTCACGGCTGTGAACGCGCTCATGTGCAAAATCTTGCAAGGTCAGAGCAAGGTGGAGCCCCTTGTGGGCGTCGG
GCTCATGGCCAGCGTCGTGCAGGCGACGCTGCTCTATGTCTTCATGTTCCGCACGTCGTTGGGGTTCGCCGGCTCAGCTCTCGCTATCTCAGCGACCATG
GCCTGCTACGCCGTCGTGCTGGCGACGTACTTGTACCGCAGCGGTCTCTACCAGCGCGAGTGGCCAGGTTGGCAGTTCTCGGAGGCGGTTCGGCTCATGC
CCGAGTTCCTGCGTTTGGGTGTGTCCGGAATGGCCATGTTCGTGTGTGAGGTGTGGGGCTTCGCGGTGGTGGGACTTTCCTCCGGGATGCTGCCCCACGC
AGCCGCCGTCGTGAGTGCAGACTCGAGCTACGCCAGCCTTCGGTGGCTTGGAGCACTCTGGTACGCAGCCATCTCGCTAGCGGGCTCTGTGAGGGTCGGC
AACGCGCTAGGTGCTAATGACCCAGCGCGTGCCTGGCATGCAGCAAAACTTGCTTTGGGATTAAGCACGGCCTGCGCCCTCGTTGCTTCGGTGGCGATGC
TGCTACTCCACGGTGTGTTGCCCTTCGCATTTACGAGCGACGAGCGGGTCGTGTCAATCACGTCCAAGCTGTTACTGGTGACCAGCCCACTGCAGGTCTT
CGCTGCAATCTCGTCGGTGTCCCAAGGCATTTTCCGTGGGTGTGGCCTGCAGTCGCTCGGCGCGAAGGTCAACTTTGTCTGCTACATCCTGATTGCTGTT
CCGTTGGGGCTCTTGCTTGCTTTCTCGTTCGAGATGGGGCTGCTGGGACTCTGGCTCGGGTTAAACGCCGGCTTCATCGCGAGTGGGCTCTTCAGCACGT
ACTGGTTGGCCTTCCGAGCAGACTGGCCAATGCTGGCGTACCAGGCAGTGCAGCGGACAACGTGTGGAGTCCCAAGCAACGATGAGGATAAGAGTGGAGC
TTGCTACCTACCGTCGCCGATGGCCGTGCGAGACGTCTCGTACTCGCATGAACCTATGCATGAGCCCCATGCATACACTGATGCCCTTCGACCGTCCGAG
GGTCTCATATGAGGCGATGGGCAATTTAACCTAAGAAAGACAAGAGTGCAGGATAAAATAACGTGAAGTACCAAAGTGAAACAACTATAAATCCTGCTTA
GAACTGGTAAAGAGAGATAACCGTTTCCCCCAAATTCGATACCTTGAGTTGAAAACCTATTTACAAGTACGAAAAACTTCACATGAAGTGATCGTGGAAT
GCTCACGGTGACTTCA