Description :
From Genome Similarity Track
Location :
Scaffold_11:72028- 73358
Transcript NameFunction/comments
Phymu_g846hypothetical protein PHYSODRAFT_309032

Sequence
1330 bases(100 bases per row)
AGCGCCGTGAGTTCGGTTGGTTGGACGATGGGCCTCCCCCCATGCCGTAATTGCAGATTTGGCACTCCTGTGTTCTCCAGTGGTATGCTCCGTTAATTAC
ATCGAAGCCCACTGCGAATTCAGCACAATACCGGTCGTACAGGGCTTCCCACTCGCTAAACGTTACGATCTCGTATTGACGAGCAGGTGTGGAGCCAAGC
CTGCACAGAAGACAAGCAACAAAGTGAGTATCAATCACACACTTCACGTTGCTAGAACGGCAGCTAACACTTACGCTTGGGTAGCTTTGAGTGACTGCTC
GAGGGAGAATCCGGAGAGGAACATCGAGATATACGGCGGCACGATCGTTCTCTGATGCGACAAGCAAACAAGCTCGGCATTGAGAACTGGTCCAGGAGCG
TCATCTCCCTGGCTGCGAACAAACTTCCTCCACTTGTTGAGCCACTTCTTGGGCACCAAAAAGTACGTGGCGTACTTGCTCCTTCCGTTCACCGACAAAT
GCGGGGCCAGTTGCTGTTGTCTGCTGCCGTGGGACTCCGTTGGTGAGAATAAACCTTTCGGGAACCCGTTCTTCCTCTGtagcagttccagcagctgctc
cgAGCCTGCGATCTCCCCATCGAGCCTCgccctcttcttctcctccgcctccagctctcTGGCCTCCTGTTCCAGAACACAAGAGGTGCAGTCGACGCAC
GAGCTTAAACTGAAGCCTCTCAGCTCGGGCGCGTACACTGCGATCTCCCTGAACACGTCCCCACTGATGATTGCGCGTCGACGGCGACCCACACATTGAG
TGGCAGGCAGCAGAGCTCCATGGGCGCAGACGATCATAGCTCCAGCCTCTGTCAACGAAGAGCTTGGTGCAATTCGCAGTGTCTCTAACGGACTACTGTC
CTTCCGTTTGACGGATTGCTGTCGTCTTTGCTGTCTCTTTGAGCGGcggaactgcagcaagaactgCTCCAGGGCCTGGCAGCGCTTCCGGTAGCTCCCA
AGCCACGCGCGACTCACGACGACGCACGAGGGAGCGCACAGTGCCGCATCTTCGAAGGAGCGTGCGTCGCAGTGGgacagaagctccttcaggTGCAGCA
TCTCGGCGCCGTGAAGCACGGCGAGCGAGCGTGGCCAATGGTCGGATGTGGCTGGGAGGAAGCTCGTCACGGCGCCAAAACGCCTAGTGATGACGCGCTC
GAGCGCATGCTGAACGCAAGGCGTAGTCGCATCTAGCGAGCGGCAGGTGGAGGTCACTTGCAGCACGTCTCGCgccgagagcagcgagaagaggTGCGCC
AACAGACCGTCCGGGAGGTGCTCCATTACG