Description :
From Genome Similarity Track
Location :
Scaffold_1385:7202- 9903
Sequence
2701 bases(100 bases per row)
AAAAACCTCAGCTTTGATAAGTTGTTTTTCTCGTGTACCCCCATTTAACTGCTTACTGTGACATATGGCAAGAATcagctctttctcctctttctgAAGA
GTATTTCCATTTTCAAAAGTGATTTTTCGTGATGACATAgcgaaaaaaaaactttcaCCTCCAGATAGTATTAATTTTAATGGCTGTATATTCAAATTAA
TGGCGCGAAAACGCAAATGAAAAAAATACTGCGTGCGGCTGCTTCAGTACCGCGTAATCCCGGACATGTATTGGCGATTATGATTTGAGTAATCCCCGCT
CAAATATTTTTGCAGATCTCCGTACGGCTGCACATGAGTCCACAGTTCAACTTTGGGCCCCAGCAACACACCAGAAGTGCCTGACAGCAACCAACTCTCA
ACTTCAATGGAAAACTCTTCACTCGCCCCACCAAATAGCCATCGACTGAGCGACTGCGTAGTTCGTAGTGTAATGCAGCGCACCAGCCCTATTGGTCGTT
CACGGGGTGCTTGTCAGAGAAGTTCGAGCGCACCAAACGCCAACGAAGCAGCGACATTTGACCGTTTACTACCGACAGGCGAGAAGAGAAAGAAATACGA
GCCAACAATTTTTCCCAACCGGAAACATCTACAGACTGTTGCCTCTGATGATGGTAAATGCCAACCAAGCGCAGAatcagccagcagcaatgaacAACAA
CCGCAGATAATCGAACTGTTAATGCTTGGCAAAAGCATTGAGCGAAGGCGCCGCCGTGACAACCAAAGGAGATATAGAAAGAAGCAAGAAGACTGGAGAG
TAAGTCTCGAGGAGGAGACGTACAAGCTACGTGAAGAAatcgatctgctgcagcgacatcGACATGATATTCCAACTAAGACCACAGTTTGGGACGTGGT
AATCGAATACTTTCGTCATTTCCGTCAAGGTCTACAGCTGGAGTGGCAAttttccaccacttcagACTTTTTGAGAAGAACGATGGCACCAGATGTGGTG
TACAACGTGGGACAAGGTCCACGGACGATCCTGAGTAGTTGGTATTATTTGGGATGGTTCAACGATGTGGAAGTGGAACTTGAAGGCTTGCGGAGAGGTG
CTAGAGGATCGCTGATAGCAACGACGACCACAAGTTTTACCATCACACAACGATCTCTGCGAGAGGTGTTTCCTCATATCTACACTAGTGACGCCACCGA
ACCGGCATTGCTCTCCCCGCTTGAGATGAAGCTTCTAGGCCATCGTATTGTCATGCGCGGTTCGAGTGGGATAGCGCATACAATCTCGTGGTCTGTGTGA
CGAGTCAATCAGACCTGTTGCCGccgatgctgcgtctggtgGGTAGTTTGGAGTTGCTATCGCAAGTGTTTGAGAAGTCCCTGGTTACCCCTGATTTTCA
GTGGAGATGAAAGTAACACGACAGGCCTACTGTACTACTTTCTACTAAGCTTGCATGCAGTAATCACCCCTTCGCATTACTTATGCTTGCGTCAGTCGGC
AAAAGTTGTTCTGCTACTTATGCTTTAGAGTCGGGTGCGCCGAGAGCTCTCTCTTAAAcagggtacatgtattcgaCGGCGTCATCTATTCATGCCCGGC
TGAATCGCTGGTTATAGTAATAACTGACGATAAGTGGTGCCGACGTAGATGCTGTCAGTGATGAAAATGGTGTCAGTGCGCCCATATACCACAAATTGCG
CCGTCGTCCAGAAGCTGACTATTCGGTGGAGAGCGAATGGAGTATCCCTTCAGACTGGGAGTTAGTTGCTGTGCGGGTGTTTGGAAACTGGGAATGCAGA
TATAAACGTGTCTGCTGTAATTTCAGTGTGGGTTGAAGCCTACAATGACCATCAAGAAGAGTCGGAGAAAAAAAATGATTCGATTGGGGTGATTTTTGTA
GCGAACAGGAAAGCGATCAAAACCACATTTTGTATACTACTATAGTACACGCATCATCCATTTTACGGAGTAATCTAATTCTGTTCGATGTTTCGGTGTT
GTTCTTAGAACGTAGTCGAGCAACGCGATCGAATGGCGGAGGTAAAACACAAGCTTATCACCTTCTTTAACTTTTATGTCAACTCGTCGCGAAAAAGGAT
GTTACATGCATGTACAGCATGGACTCTGAGGCAGCTTTCGATGTGTGACAATGATAGATCGCAATGGATTGTCTCGATTATTGGCAGTCGCTGTGGGATA
CTAAGTATAAACCACGTTTTAAGACCGTGGATAGTTGCTACACGTGCAGAAACAaaaatactacatgtagaaggAGTTCATTGTGCCCCGCTTTCCTAGT
CAGGTGCTATGGAGGAGAATCGACAGAGATCCTCGGATACTCCCAAGATTTATTTACGCTGATTTGGTCACGCTCATCGACCACTCCGCGTCAGGCTTCA
CCAGCATTAGTTTTATTTTGGCCACAACGTAATGTGAATTTCGTGTAGATTTGCCAAACGTGGCTACAGGAAGTATTTCCGCAAaatacacacacacatc
CGAGTCAGCAACCGCCGACAAACGCGGACGGAAGTTCGTCGGCAGGCGCTCATCCGGAGGCAAGTCCTGACAAGCCTCGAGTAGTACTAAGTACAATATT
ACCTTTaactttaaaaaaaaactgttATGTAAATGTGGAcgctgtttcttcttcaaggTAGAACTCAAGTCTGCGCAGCTCGTTGCTTTCAAAAGACATT
C