Description :
From Genome Similarity Track
Location :
scaffold_93:72014- 74205
Transcript NameFunction/comments
g88.t1 hypothetical protein PHYSODRAFT_345966

Sequence
2191 bases(100 bases per row)
CGAGTATTTGGCTACTTGGTGCGACGCGTGAACCACAGTATCTCGAACTCGGCGGACAGAGGCGCTTCGACGCCGTCATACTTGCATATCGACCTGCTGG
ATATCTTCGGCTTCGAGTCGTTCGAACACAACAGCTTCGAGCAGTTCTGCATTAACTTTGCGAACGAAAAACTGCAGCAGAAGTTCACGATGGATGTGTT
TAAGACGGTTCAGGAGGAGTACCAGCAAGAGGGCGTTGCCTGGGAATTCGTGAAGTACCGCGACAACCAAGACATGTTGGATCTACTGGAGAACTCGATG
GGCGTGATGGCACTGCTGAACGAAGAATGTGTGCGCCCCATGGGAAGTGATTTGTCATTTGTATCGAAGCTTGTGTCACTGCGCGAGTCACATCCACGTC
TTGAGCGAGCACGCCTCAGTCAGACGCACTTCATGCTGCACCACTATGCGGGCCCCGTGACATACGACGCGGAAGGCTTTGTCGAGAAGAACAAGGACTC
GTTGCAGACTGATCTACTGGAGCTGCTTGGTACGAGCTCAAATGGCTTGCTGTCGATGGTATTCGGCGACGACAACAACACAGCATTCATGACAGACGCG
GATCTGGCTGTCCGTGCGGCAACCATGATGGAGTCGGGACGACGCAGTACTGTCGGACGGAAAACGTCAACCTTCATGCAAGAGACCGTGAGCTACAAAT
TCAAAGCACAGTTGTCGCTGTTGATGAGTGACATTTCCAGCACTGAGGTGCACTATGTACGTTGCATTAAACCCAACTCGCAAAAGAGCCCGAGTGTCTA
CGAGATCGATGCGGTTGTGAACCAGCTTCGCTGCGCCGGTGTCGTTGAGGCCATCCGTATCACACGCGCCGCATTCCCCAACAAGATGGCTCACGAAAAG
TTCTTGCGCCGATTTGTGATGATGCGAAGCAAGAAGGGTGCTACTATCGCTGCAGCATCCACAACTGTCACTGAGGCTTGCGAACAGCTTGCGAAGGAAC
TACTTAGTGGAGATGACTTTGCCCGAACGCAAGACGGCAGTGAACACTCCAGGACACCAACGTTCGTGGTAGGTAAGAGCCTGGTCTACTTCGGCAAGGA
CGTGCTTGAGTTCCTGGAGCACAGGCGCACCACTTTCGTGCATGACCAAGCAATTGTGATCCAGCAGACTGCGCGCCGGTGGATGGCGAGACGAAAGATT
AAGAAGGTCCGCACAATGATCGCAAAAGTTCAGGCCCTTCAACGCTGCCGGATACAGCGCCGATCATACTTGGAGAAGCGCAGGAAGTGCACCATTGTGC
AAAGTGTGTGGCGTGGAGTGCGCTCGCGTCAGCGTGTGTATTTGATGATGAAGGAGAAGAGCGCGATCAAGGTCCAAACTGCGTACCGTCAGTATCTCGC
GGAAAAGAAGTATGCAAAGTTCCGGAATGCTGTCATCAAAATGCAAAGCACTCTTAAGATGAAGAAGCAAGTGGGCAAGTACCACAAACTTCTGTCTGAA
CGAAAAGAGCAGGATGCAATGGAGACCGAGGTAGAGCTTCTCAAGCACCGTCTTGAGGACGAGAAACGCGCGCGCATGGAGATCGAAGCGGAGAACTCGT
CGCTGCAGCAAGAGCTAAACCAGGTTCGGAATTCCTCTGTGCCTAGTGCGGACAGCAGCATCTATGATACCGACGCGCCCCCGGTGTACCGGAACAGTAT
GCGATCGAGCAGGATAGAGCGCGAGTCCATGGACGACAGCAAGCTGCTCGACGACTCTGAGCGCATGATTGACTACCTGCGCAAGGAGGTGACGAAGGGC
CGTGAACTCATTCAGCTGCTGTCCCAGGAAAATGAAAACCTGAAGTCTGAAAACAAGAAGATCAAGGATGCCTACACGGCTGCTGGTGCATCGTTCGCCG
CGCTTAACCAGCACAATAAGCAGCAGTCGAAGGCCAACCTGCGTCTCATGAGCACCCACGCTGCGCTAATCAAGTCTCAGGAGGAGAAGATGAAGAAGTA
CAAGAAACAGGTGGCAGAATTGAAGGAGGATCTGCGGATGCAGCGCTCCGTTTACTCGGCAGAACTCAAGGCTCGTGTGCAGCAGCAGGATGTCCTGCTA
GACATCATCAACCTAGCGGAATCCGACGGAGTCTCGGAGGACCTGTTGGAGCGCATGCGGGCGATGGCTGTGGACTCGAAGCCGTCGTATG