Description :
From Genome Similarity Track
Location :
Scaffold_1184:7201- 9343
Transcript NameFunction/comments
Phyta_totarag12326hypothetical protein PHYSODRAFT_319656

Sequence
2142 bases(100 bases per row)
TTGTCGTTGAGGCGACCTGAAGCTGCGTGCGCAAGAGCTGGTGAAAGTGCCACATGGATGCATGTTGAAGCACATGCAAGCTGTGGGGGCAACGGCGAGA
AAGTTAGCTACAGTATCATTTCAATTTGGTAAGAGAGCACAATCCGAGTCTTGCAACCTGCAGTACCTTGGCCCCAGCTTCTCCAAGTAGATAATCTAGT
TCAATAGTACAAGGGTATGTCAGCAATATGCAGGCAAGTGGCTCGAGGGCCGCTCCAAACGTACAGCGTTCTGCTGGATAGCGAAGCGGGCTTCTAGATA
GATAAGCATTAGTCGGATAAGACGGATCATCCACCCCATGAGTCCACATAGCAGAATCACTGCAGACAAATTCCACAGCTCAGGGGAGAGCGATGACGTT
TGCATTGCAGGTCTTGTCAGCTACAAATGTACACGCCAACGCCTCGAACTCGGAAGGTCCATCCATAAATAATGATGCAAGAAAAGCTCACGTCCACATT
TGAGATTAGCCATAAACTACTTACAGCAGCGGGGTGTTGCTCGTCTTGTTCAGAAGTCCGAACGCAAGCGAGTCCATGATTCCAAGAATCTACAACAAAC
ACATACGCGCGTGTGTCCAGTAAGTACCCTACCTAAAGAGATTATGACAGGAAAAGCGTAGCAATTACGCACAGTAAACACGCCGCCCACAATAGCGCAG
ACGCTTGTGAGGAACTGGAGGAAGCCCACGCGGTACTGTTCGATGCGGAACATGATGGGCGAAAAGGTGTAGCTGAACGAGACCACTGCAAACCCATGAC
ACGATCAGACGGTCAGTCTTCAATTTCAACCACAAACCGTGAAGGAGTAAATTAGTTTGCAAGACGTACTCGGGAGACCCTTGTCGCTCACAGGCGTAAG
CTGACGGAAGTGCTCCGTGGCAGAAAATTGGTTCGTGATGATACGGCTAGCAGACAGGAACGTGTACTCCGTCGGCACCACCTAATAACGCGAATGGAAC
AATGTCAACCCCGCTACAAGGCTCGACTGGGAAAAGATGCCCCAATGCTGTACCTTAAGGAAGTACTGGAACGAGCCACGAGTAGATTCATCCGGGAGTT
CCTTCTGGCGATTGTCCAGCGGGTTCTTCATGTCCTGTTTGCAAGAAAGTAGCAACGTGTAAAATATAAGCAAGGTCGACTGCAATGAGCAAGCCGCTCA
AGATCTTACCGGGTACGCTTCACCAAAAGACAGCGAGCGGATGGTGTGCGACGTGTCAAAGACTTTGAAAGTGGCATCAACCAGATCCTGTGCTGACAAG
TATCCCGAGCGGAAGAACTTGGACGGAGCGAAGTACAGTCTGCCCGCGACCTATACACAGGAACGTCAATTATCAGGCTGTGCCTCGTCCCCCCAGACAA
CAGACAGTCTCAGATCGTACCTTGGACACGACGAGAGAGCCCTTGATCCGGCATCCTTCGTCCACTTCTCCACGGAGAACCTTCTCAATCTCCAGCTCTT
GGCACTGCGAGATCGTGTGGAGACTCGGCatcatccagctcttccgagCGTACGCAGTCTTCACTGCCTCACACGTGTTGCAGCACTACCGCACAACACA
CCACCAACCCATCAGTTCAGCTGTCCCTCCTCCGCCCTCACAGACAGCAGTATCAATACCTCTCCGGGCTCCCCAGCAGCGTAGCAGCTTCCACACGCAG
GTCTGTTTTCCACAAAGTCACCacagtcagtcagtcactCCCTTCTTCTCCTATGCGTCCACTCACTTGTCCGTCTCCCCGTGCAGATCTGTGTTATTGG
TGAGCGCGCCGCCTATGACGTCGCGCATGCCTTCCGCCAGCGCCTGGCCGTGGCGGtccagcggcgtcttctcgATATCGTGCTCGATGTCGTGCTGCGC
GTTGCCCGCCATGTCCGCGGACTCGAGCGCCACCAAAGAGCAAGGCATGCGCGGGAActcgacgtcgaagttgaTGGAGACCATCGTGTTGCGGCCGCCG
TCCACCACCATCTTGTCCACCGTGTCCGTGGCCAAGTAGAAGcgcagctccgacaccagcagcagcgatatGCACGCGAAGGCCAGCAGAGAGAAGACAC
CGCCATGCAGCGTGCGCACCTTGAATTCCTCGATCGTCTTCG