Description :
From Genome Similarity Track
Location :
Scaffold_62:7200- 12842
Transcript NameFunction/comments
Phyin_T30-4PITG_18408Putative uncharacterized protein

Sequence
5642 bases(100 bases per row)
AGGGTGAAATTTACCTCATCAGCAAGAAGTGTCTTCGGTATCAGACTTCGAGACAGTAGCGGGAGGTATATTGGCCCATACAGTAATCAAGTTGAGTCTA
CCAAGTACGCGTGTCAGTCGCCGGAGTTTGCAGCTTGGCCGGTCGATCGTTTTCACTCTCGCCCTCAACGCCCCCGCTATAGGAAGCGGTGAAGTCTAGC
GAGGAAAGGAACAAGACCCCGTAAAAAAAACACACACACCACGTCGATCAAGGTCGTCAACCTACCTGGCCCGTAGCCTTAAGAGTTTCCACGCTACGCC
ACCCCCAACCATCCTGCGTAGACGGCAAGACGGAACCAACCCAAGCCAAGCGTCCCTTCAAGCTCACCAGATGAGTGTAACGAGCCCCACCGACGGGTAC
ACAAGGGGAGCCCTCAGCAACCCCGCGGTTACCGGAGTACCCCTCCGTCAGTCGGTAGTCCGGGGCACGGTGTGTGAGAATGGATCGCAAGTTTTGCGTA
AACCACTCCATCACAATGGTGCGCGTGCCGGGGTCTTATGGTGACTCGTAATTTCACCGTGAGTCCCAAGAAGAAGAGGAAGTGCCAATCAAGTTAAAAC
CAAGGATGGAAGCGTCATCGGAAACTGGATCGAAAACAACGCTGCAGAATGAATCATGATCAGCAGATCGACATAGCTCTGGGAGGATCTCTGCCGACAT
TAACGATGAGGAATCTCTTCTTAAAGAGAAACCGCAACCTCCTCCCTCTGAAGGCACCGCAGATCGCAATGCGCATCGTGATCTGCTTGATGAGGAATTC
AAGGTGAAAACCGGAGGAGCCTCACCAACCACCGCTCCGCCAACGCAGATGACCCCGAAGAAGAAGACTTCGTACGCGTCGCGGATGAGGCTCAAGGCCC
CAGCTGATTCGGACTCCGATAGCCACGGCAAGATCGCAGCGACTTGGTCTGACGATCAGTAGGAGGAAGAATACAAACCGCATGAGCCTCAAATGTTTAT
GGCCAAGAGCCCAACGATGCGAATCGTACAGCCGCTGATGTCTGGATCGCTGAAGGGGCCGGTGACACCGCCACCTGAGACGACGACAAGCTGGAGGCTG
TGAAAGCCATACCGTATCTCCTGAAGGAAGCCGGCGTCACGCCAGGCCCCTTTGCGGCGAAGGATCTGTTTGATCTGGATCTCAAAACGATCCAGAACAC
ACAGTCGGAACTCTTCGAGAAGTTGAAAGCGTTGGTCGGCAAGTCGCAGACTCAGATCACGACATAGTCCAAGCCCGCCGCCGGCCTGCCACGACCCCCT
AAATCGGGGTCACAGACCGAATCGTCTCAATAATCACGCTATGCCTCCACGGTTTCAAGTGCATATTCGGAAAGTACCGACTGTGCTGAACGGATGCAGC
TGGGACCGTCGGGCACGGCGCTACTGCAGTGTCGACCGGATCGTGCGCAAAAGGCGGAAGCTGAGGCAGACTCGCCGACGCGGGGCGACCGGCACTGGGA
AAATCCAAGGAGACTGCGGAGGTTTTTAAACTCAGCGATGGAACGTTGTCTGAAAGAGTAGCGCCCTGCACAAGGGATACCGACCGCTGCACCGGTAGCA
GCGGTCAGACAGCACGACGTTGATATGGAATCGTTTGTCTCGGAGCACGGTGAGTACGATCCAGACGAGCTGGACGTCACTGTCACCCGTCAGCCGACAG
TGGCTACAGATGCTACGGCCATCGGAATGTCACGCATTCGCGTATCCGCGATGTCGGAACTCAAGGAGTTCTCCGGGATGGATAACGACGAAGACCGCGC
GCGCGGAGATCAGCAAGGTAAAGTCGGCCTTCCTCCGCGATCAGGCCCCGAACGTTGTGACGTGCTTGGTGCTTGGCGGCCTGTTCACTGGATCGGCGCA
ACTGGTACCGGCAACTCAGCCGGACTACTTGAAGCGAATTGAAGGAACTCCTACGCGAGTTTCAAGTGCAGTTCTGTGGGTCGGCGTATTCGTTGGAGGC
AGTATTACCATGCGAAGAAACGTGCCGACGAAACACCGTTAAATTACCTGCTCCGTCTGAGCGCTGCAGGATTGAGGGCGAAGTTGCGTATGAAGCATGG
CCCACCGGATGTCCGCCGTGAGCACGTAGAACACTTCATCGAAACATTGGACGACCGCGATTTGGCTGATCAGCTCGCGCTGCTACGGATCCCAGATGCA
GATCCGCTTGGAGGTATCTTGAGAGTGCGACAACGCGCAAGCAACCGTCTGGGGAAGGACCACTTTGAATCGAGCAAGTGCTGACAGAAGATAACCACTT
CTGATGCCGTAAAATCAAACCCAGCACGCAAGGTGCAAGCCGTTATGGCTGCGAACTGCGACAGTGATTCTGGTAACAGTGGATCGGAATCGGATGGTGC
TCTGCGCCGGATCTACATCGCCGCAGCAGAAGAAGATGATCAAACTCAGATGTTATGACTCCAGGAAAAAGACAGATCGAGTAGATCGAGCCACGCCAAG
CGAGACGCTGGCCTTACGAGACCCCGATCCAGGTGAACGCCGACTGCATGGACGTGGCCCATTCCAACGCTGCACGCACTGCGGTTCGCATCGTCACGAC
GATCTACGTTACTGGAAGCACGTGTCAGCGCTGTGGCAAGAAGGACCACCCATCGGCTCGTTGTCTCTTCGTGTGCCGCGGATGCGGCGAGATCCACAGG
TTGGTAAGTGCCAGATGGAGGGGTTTTACAATTGGATCCGTCAGTGGTACAACCCGGCCAAGCATGGCGGCGTGCTGCCGGAAAGCGCCGAGAAGATGTT
AAACACGGGCGCTCGAAGCCAGGACGAGCCGACCGTTCCAAGCTCTGCATCTTTGCATACGTCAAGAAGAGATCCAAAGTTAGTGAGCGGGAGAATCCGA
GCGACAATACATGTGATGTTCATGGAACACGTGCCGGTGTTGTTGCAAGCCTTCGCGAGCTTGATGAGTTCGCAAGAGTTGATACCGTTATGACGCTTGA
TCTACTGCCAGGAGAGATGCGTAGATACTGGAATTACCACGCACCCAGTAAGTGGTTCAAGCAAGTCAAGACGGGAGGGAAGATCAACAACAAAACTGCG
AGCTTACTCTTAATTTCCGGCGCCGAGGTGACCATTCTGGACGCCGCCTTTGCTCGTAAGGTTGGGTGCTATGTGGTTAAAAGTCAACGATAAGAGTGGG
TTGGTATTGGAGAAGGTGTGTACATCACGATGGGACGTACCAAGATCAAGATTACCTTGGATGGAGCCATGGTGTACTTCTTCGACGTGTGGGTCGGCGA
GATGTCAGACCAGGACGCGATCTTCTGTATGGATTTCATGGTACCAGCGGGGATTCGCTTGGACTTGGCCGACGGGACGCTATGCTTACCCGAAGAGGTC
CGCATCCAGTCGTCCGGACGACACCCGCTGTATGGCGAATACGTTCGCCCAGTCGGTTTGGACGGGCTCAAGATAATAGACGCGCGACAGAGCATCGAGA
TGCCATTACGACCCAAGCCATCGGAAACGCTGTGGATCACTCGGGGAGAGCAATTAATTCCCACCGTGGTTGAAGGGCATGCACGCAGGCGTTACCTGAA
GATCACGAATGTCAGCGACCGGACGAGGTGCCTACTCGCTAATACCTCGGTAGGCATGTGGCTGTCAGGAGATAGTGTACCAAGACGTCAAGGATTCATC
ACCGTAGGATCGCGTCGGTACGCCGAGTGGTAGAATCTGGTACTACAGGCTAGCACGGATGTGACGATCGAGGAAGATAATCCGATCGAGAAGTCGACGG
AGCCGATGGTCTCCCATCCGCAGTATGACACACCGACAAGCATTTTGAGACGACCCATATGTTGGGCGACCGGCAGCAGCCAGATCATGGAAGCACCCAA
AGCCAGGAGGATCGAAGTCATCGTCGGAAAATGATCTGGAACGCAGACTGTGCGAACCGATGTGCTAGAAGACCAGATCGATGGGCCGACAGCGGTAGAC
GGCGAGATCGCCACCTGCAGGTATATACAGATCTCACCAGTCAGCAAACCTGGGAGCGGGGTAGACGGAGAAGCTGATCTGATCGTGAATCCGATGGAAT
TGGAGCCTGTTGTGAATGCGTCAAGCACGACCCCTGTGGAAGATGACCAAGTCTGCATCAGCTAAGGGGGCGAGCTCTTTGCCGAAGCCGTAGATGCTCA
GTTGACAATCTTGCCAGAGGTGACGACGACGCCAGGAAATGTGAAGCTTGAAGACGTACGAATCGAGCATGAAGGCTTTGTCGCGCCAGAGGATGAAACT
AGGTTGAGGAAGATCATCTGGGGCCGACAGCAGCTTCTTCTCGGAGAAGGGAACGCCCTGCCGCCAGCCGCGCGAGGCGTCTACTGCGATATCGATACTG
AGGACGCCAAACCAGTGGCTCAGCTCGTGCGTCGAGTTGCGCCCCAATTTCGAGATAATTTATCCGACTTGTTCAAGGGTCTGCTCTCTGCCCAGATCAT
CAAGACTTCTAACTCGACGCGGGCGTCGCCGATCGTGGTGATTGTCAAGAAGAATGGAGTCAACATCAGACTCTGCATCGATTATCGTGTGGTGAGCAGC
CTGACACGTCTCATGGTGTACCCCATGTCGTTGATCAACGATCTCCTGGAAGACCTAGATAAGGCACTCTGGTACTACTCGTTAGATATGGTGAACGGTT
TCTGGGTCGTGTCGATGACCGAGCGGGTGCGCCTGGTGTCGGCGTTCGCTACGCCGTTTGGTCTCTTTGAATGTCTGTGTTTGCCCTTTGGGCTAAAGAG
CGCCCCTCAAATCAACAAATGACTTCTGGACAGCGCACGGTATGGCTATCTTCGGATCCCCGAAGAAGGCGACGAGTCAGGTATGGCGGATGCGTTGGAG
ATCGGTGAACCTGACGTAAATTCGGGACCGCCTGTGCTGGGACGTCGCTCGTACATCGACGACATTCTGGTGACCGCTGAATCATGGAACGAGCTCTGCA
ACAGAATAGATCGACTGATAGACGCGTGCGACCGTTGGAACTTGTCGATCAGCGTGGTTAAGAGCTCATGGGGCTGCCGCAGGATAGACTGCCTGGGACA
TCGCGTGTCAGCGGACGACCTCGAAACCCCTTCGAAGACCTCGAGACTCTGACGGTTTTGCCATTCCCGCGAGCACTGCAATTTATGCAGTCTTTCCTTG
GTAGCCTTTACTACTACAGCAGATTTCTTGAGGATTTCGCAATCTACGCGTCGATCTTGTATGAACTGCGAGAAGTGGATTATCACAAGAAGGACCCAAA
ATCCGATCGAGCTGCTGGGGGCGAGGACTGGATCACCTCGGCGGATGAAACGGACAAATGGGATGGAGCGCGAGTAACGTTCGACTGCTGAAGAGCAAGA
TCGCAGACGCGCCAGTGCTCAGGCACTTTGACCCCGATCGGACGCCAGTGATTGTCGTCCACCCGAGTGATTGGGCGATTTCGGCGGCCTTGATGCAGGA
ACACGACGGCACGTATATGCCGGTAGCGTTTACCAGTCGCACGTTGAAGTCCAATGAGTTGAACTACGGCACCGTTGAGAAGGATATCTGGGCTCTTCTC
ACAGGATACTGAATGTCTGTTACACCACGCTGGTCTCGAGAT