Description :
From Genome Similarity Track
Location :
scaffold_160:720- 37713
Transcript NameFunction/comments
Pl_108538hypothetical protein PHYSODRAFT_469149
Pl_108539conserved hypothetical protein
Pl_108540hypothetical protein PHYSODRAFT_373584
Pl_108541endo-1,3(4)-beta-glucanase, putative
Pl_108542hypothetical protein PHYSODRAFT_374691
Pl_108543hypothetical protein PHYSODRAFT_472892
Pl_108544protein kinase, putative
Pl_108545aspartate aminotransferase, putative
Pl_108546kinesin-like protein
Pl_108547hypothetical protein PHYSODRAFT_474252
Pl_108548hypothetical protein PITG_03758

Sequence
36993 bases(100 bases per row)
GCATCCCATTGTATAGCAATTAAAAAATTGTAAACGCATGTCATATCCCAAACCGTTTCAACAACCATCGTCAGTGTGTGGTCTGTCCGCAGCAAATTTA
GTGAAATGACACTGTATTAGCTTCTTCACTCTTTGAACTCTAGCAGCGTTCGGGAGGCTAGCACGCCCATATCGTAGAAAGAAGACACTGCAGCGCGCAG
CAGTCGGATCTCCGTTGCCTCGAAGTGGCTGGAACGCACCACCACCAATCAAGCAGCAGATAGTTCACAACAAGTGTCAGCTCAACGTAAAGATACAGCA
TATTGCAATGACATAACAGCAACACGTACACGTGGAGTTCTGTGCCCTTGATGGTCAGCGTACGGTGGATCTTCTCGGGTTGCAGCTCCTCGTCCACTTC
TAGCGTCTGAAGCACGTACTTCGCGTCTACTTCCTCAGGGAAGTTCAGACTGATCTCGCTGCACACAAGAAGACAAGGAGAAGACGACAAGGTAAACGTT
AGGTCCATACACAGAAAAGTTGCAAGGGTAGCGTTGCAAGGCGACGAACCATTCGAACGGGTGCGTCTCGCTGGGCATTGTTGTCGAAGCCTGACGATTG
CAAATGTGGTGCACACAAATTCAGTGTGGCTACACAGTGGAAGGTATATCGTGTGGCAGACACGAAATATGCAATTCAATCGTATGGCACCAGCGCTGCA
TCGTCGAGGCACAGTCGATCCATCGACAACATTTTCGCGTCAAAACCTCTCTTTGATCCTCACATCGCTGAGTTCGTTCCGGAGAGGAGACTTGCCCTCG
ACTGTAAAAGCTGACAATGAAGTACTGCAAATTGCGCAATAGCATGTAGTAGCGCGACACAGTTGTATCCACAGCGACGATTGTCCTTGTCGATCAGCGA
TGCAGCTTCAGCATCCACCATCACAACCCTGGCATACCCAGCAGTACAAACTGAAGGAGAATTCACAAAAATAAACTGCAGCTGGTAAGGTTTGTGGTCT
TCTTCATCGGTGAGCGTGCTGGAGAACCACAACGTGTGGCACAAGGCTATCGCTCGAGTCGCGTTTGGTAAGGTTTGTGGTCTTCTTCACCGGTGAGCGT
GCTGGAGAACTACAACGTATGGCACAAGGCTATCGCTCGAGTCGCGTGGTGACCCTGTCAAAAGCGCCCGTCCCGTCTCACACACACATCAAAGCGGCCT
CTGAATAGTTTTCACACACCTCAATTGGCCAAAATACAGTCAAATCATTCTATTTCCACCAATCACAACTCACGATGGACTGAATACTTGCAGTTGCAAC
GGTCTCTGTTCGACAATTCCCATCCAAAGCTCAATGGTGCTCCCTCTGTTTTCTACGCCTCTGCATCGACTTCCAGGCTGGAAGTTCCAGCGCGTCAAAG
ACTCGGAGCCCAAGCGTGTCAAATCGGTCTTCGCAGCCAAAGCCAGTTCCGCCTTAGCAGGTCTCGTACGAACTGTTCTCAAGTCTAACACCTTCGCATG
GGGCTGCTGTGTTGCGCCGCAAAATGCTGTGGCTGCATGGCGCTCTCGCAGCTCTGCGCGTTGCTGCTTCCTCTGGGCATCTTGGCTGCACTCGGTCTGC
TCTTCTACACGTACGCAATCCCATGGGGTGAAGACCAGATCCGACAGGCGCTCAATCTCTCGTCTGACATCGACATCGGAGACTTAAACACCAGCTACAT
CGAGGCCAATTCCTGCTCCGGCTGCGTCTTCGGAAGCAACACTCAATGGCCCACCAACACCACGGGCACACGGCATTTCCTCGACTCCAAGGCCGGCAGT
ACGGCGTCAGGGGTCATCGCCACGTCTTTGGCTGGCGCAGCAGTCATCGGCACAGGTTCCATGCTTTGGGCCTCTGCAATGCCTAGTGCTGCTGCGGCGC
TGAGCTTTTCGGGGGGATTCTACGAGATGACCCATATTGTTGAACAGGCCCAGTTTGCAGGAATGATCAGTCAGCTCAGAATTGAAGGCGCACCAACGTT
TCTGTTGGAGTTCTCCAAGGAACTGTCGTGGACGAATTTTAACTTGATCAAAGGAAGCAGCGATTCTAGCAGTGGAAGTGGCAGTGATGGCAGTGATGAT
GCCACTCGAAGACTTGCTGATTCTAGTTCCAGTGCGACTGGTGTCGTGGCTGCTGTGGGAGAATCCGGTCCCGCGAGATATGCAGCTCTGATCGGTGTGG
ATGCTGACGACCTCTTCTTCTACACGCTCATTACGTTTGTCGTTGTAGTTGCAGTGCTGCATGCACTGTACCTGGTGTTCGTCTTGATCGTGGGTTCTCT
AGCCAAGAATGAGTCGTTCGGAGATGTTGCAAGGAAGTGGTATCGCAAGGTCGTCTGGGCAGGTGTGTTGGCTCTGTTGCTGGCGCAGTACATGTTCGCT
ATGGCTGGAAGTTACTTCGTTTCGGAAGGATCATCAAATGACTCAGCGAACGGTTCCAGCTCACGCTACGCACTTGGACTTGTTGCTCTAGCAGCTGTTG
TGCTTTTGGCTCTCGGTCTTGGTATTATCGTTGTTGGCAACAATACCGATGAACTCAAGGATGTGGGTACCTACGAACACGACCAGCGCGCATTTAGTAG
CAAGTACAGCGCCTACTACGACGAGTACAACTTCGACAACCGCTTCTTCTTCGTGCCCCGCATTCTACTGGCAGTTATGACTGGTGCCATTGTTGGTGTT
GTACGGGATGCCACGACTCAATTGCTATGTATCCTGGCGATCACGATGGTGTACTTGATCCTGCTGCTTATTCGCCAACCGAACTTGCTGCGGTTCCTGT
ACTACATCGGCATCATTTCCGTATTCATGAAGGTTGTGCTCATCTGCCTAATGCTCATTGTGGCGAGAGATGACTACTTCCCCCAGTCCGTGCGAGACAA
CGTGGCATACGGTATCATCGGCGTGAACATGTTCATCTTCTTTTTGCTATTCGTGCGCCAGGCTTACACAATCATCCACAAGATGGTCGTTGCCTGTCGT
CACAAGAAGGATGGCAAGAATTCCAGTCTGGATGCCACTGACATCAACCTCGAGTTCGGTAACAATACGTCCACTAATGGCCGCCCTTACGAGCAGGTAG
AGACAACACCAGCAGGTCATGGGGCAAATTGGTACGCAAACAAGCAGCTACAAGAGCAACAGCATAATCAACCGCAGCAGTATCACCAGCAGCAACAGTC
ACAGCAGCAGCAGTACCAGTCACAGACTAGCGCTATGTCAGGTTATACCACTACAAGCTCCCGTAGTGGACATTCGGATAACGTGCCCATGCTGGAGCCG
GCTCCGGAACCTGTTCCAGCTTTCAACCGCTCTCGGGGCAAGATTCGTCCTCCGGTTTCCCGCAACCAGCAGTACTCATTTGGAGGCTCAGGTCGGGGCG
GTAATGCTTTTGAAGTAAATAACGCTGCACCAGCTCCTGCTCCTGAACCTGAGCAAGAAATCCCGACGTACGATGTGCTGGCGGCCTACCTAGGAACGAA
CAAGACGAATGATGAGGCTGCGTACTCTACCTCACCCAAGTCAGGCAGAGGCCAATCTTCCAGAGGCCAGCTTTCGTCGCGAGGACACAACTCCACTCGG
GGTCAGAATTCATCTCGTGGGCAAAAATCGTCTCGAGGTCAGAACTCGTCTCGAGGTCTCGCTTCGTCAAGAGGTCCACCATCATCGAGAGGATTATCGT
CGAGAGGAGGAGCTGCTGTTGCATGCATGTCAGGGTCTGGTCTTGATTCACGTCCTTCAACGGTGCCGCTCGATGCATATGCTGAAAGTTTCTCCGGTGC
AGACTCGGGGGTCAGTACTTCATCGTCGCGGAGGAAACGCAGTTTCGATATGGATGCACTGCGCAATGATGTCGACATCGATGACGTGGATATCGACGAC
AACTTTGCTCCTGAGCCTGTGCTTTCGACGGCTCAACAGAAACTTGCTCCTGGTGCGTCGACTGTCGGTCAGCCCTTTAACCCTGGTGCTTCAACAGCCA
GCTCGCTTGCTATGATGAAGCAGTCTTACGTGAACTTCTCGGACTCTGTGGTTTCATCCGCTAGCAGCCAAATGGCCATGACGCAGAACACCGTGAAGCC
TGAAAACACGTTCTCTGCTGCGATGGGCGCTGCTCCAACGAACAACAACGGTGACTATGGTACCAGTCCTCAGGCCAAGATGTCTATCTTCTCGAACGAT
TCCGAGAACAGCTTTGACGGTGACAGCAGTGGTTGGTTCAAGGCTCGATCAAAGACTGTGGTCAGCACGGACACAGATGAAAGCGGAGCCAGAGATACCG
ATGGTCGAGGAGAGTATGAACTTGGTCCTCTCGGTGTGACCAAGTCTGCGTTCTCGCAGCGCGACTCGGTGGATTCGTATGGCTATCAGTCAATGGCCAA
GTTCGCAACATCTCTTGTGGATTTCAATGCCCAGAGTCAAATCACCGACAATGGAAGCGACGATGGCAGGTATTACCCTTCACATCGTCGAGGTACAGGA
TCGTCGAACCAATCATCAAACCAGTCCTTCCTGAGCGCTCACTCCGATGACAGCACCGGGTATTACGATGTGGATAAAGTTCGTCATGACCATGGCCACC
CTAACACCTTGACGCTGTAAGGACTCAGCAATACCCAACTACACACTTCCGAGTGATAGGAAGCCACCAGCTCTAGTAGTCTACGTATGTATAATGGAGT
TGGTATCTTCAATCAATGAACAAAATGTGCACAATTGACTTTGTACATGTATGTCCTCAAGTATCCTCTAAATGTAGCCATCTGAAAGATTGTGTGTACC
ACATACACAACTGACCAATTACATCATTGAAAGTCCTCTAAATGTAGCCATCTGACAGATTGTGTGTACCACAGACACAACTGACCAATTACATCATTGA
AATTGTCAAAATGGTTCGCGATCGCGACAGCGCGGGGCGGCTGCTGCGCGTGCTGGGAGACTGTGAGCTCTTCCACGTCAGTTTCACCTGATTCTCTTGT
TTTCATGCTATCTATCCATGTAACTTTGGGCTTCTAATGCGCTGTGGTTGTATAGATGGAGGCAGCTATCGACAATCTGAGTCGTGTCAAGACTGGAATC
AGATCTGAGTCCTTGGTAAAACCCAGCGTAGACGATATGGATGTACTAGAACGCACGGCTAAGGTGTCATGTAGTGCATTTTACTACTGTCCAATGCTGT
TTGTACTGGCTGTATTGCTAATTCATTGATTTTTGAACTCTCGTAGGGGCGAGTGTTGTCACTCTCGGACCACAAGCGAATTGCAAGGTTGCAAGCGGCT
TTGACTACTATAGCAAATGCTTACGATGTTCAGGATGGAGCGCAAACAGCTGAAGAAGTGGATTTTAGCCGGAACTTGATCTGCACTGTGGCTGGAACTG
CTATGATGCAATCGATCCGAGACTGCACAGCGTCTCGGACAAACTGTTGTATTTGGAATCCGAAGGCGGAGAAGCTACACCTTTTGCTGCATTGGATGGT
GAATCTCGAAAGCGATAATGTGGTATTTTCGCGTGATTACTTTCTGCAGTTGATGTTGGAATGGATTCAACCGACGGCTGAAAAGCAGAATCAGTTGGCT
GCCTGTCTTACGCTTTTTGAATTACTGCAGCGACTTCGCCACAAGTTGACACTCACGTCTGACAATGAGAAATCATACATCTTGGGTACTCGAGTTGAGG
TATACATGGATGCTCTGTGTGGTGTTGTAGAACGAGGAGTAATTCGGGCCGCTGACTCTCATCGTGTCAAACCGTCAAAGCTTGCCCTGATCGCAATAGA
AACACTTGCACTGCTGTGTCGAGACATCGCAGCGGGATATATGGTCATAAGTGAAGCTGCAAAAAAGAGTTTGGTTGGTGGTGGCGTGATAAGGAAAATG
GTGGAGAGCATGCAATTCGTGTTAGTTTCGCTACGACAGTGGCATCTACACTCAGCACGCCGCCAGTTCCTCGGATATGCGCTTCAGCATCTGCAGTCGT
ACGTTGTAGTGTGCGATAATCTCTTGCGAAACGAAAGTGGAACAGGGGGTGATAGAATTAGTGGCTTGGGTGTAAATATTCCAGCAGTGCTGGATATATT
GTGCTGGCACTGGGTGGCAACCGCCCCAACACTTTGTACGCGTTCTGGTACATCGTCGAGAATTCAGAAGAACCGACCGTCCGAAATTCTCACGCAAGTA
ATAAAGAAGTGGACTTACAGTATGTTTGACAGCAAAATGAAGTTTGATTGCGGCATTAATCCTGAGGTGATGTGCGCTCAGCTACGCTTCGTGTGCATAT
TGGTGGATTCAATTGGTGGAGTAAAAGGATGTTCCAAGATTTTTGGTGGTTTCTCAGCAGAAGTGAAGGCGTCTTTTGTGTTCTTCTTTGTGCAGAGTTT
GTGTGGAGCAACCAAAAATCAAGATAATGCGACAGTTCTCTTCATTTTGAAAGTCCTGAGGACTCTTCTGTTACCAAGTGATATACTCAACCTTTTGAAC
TCACAAGATGAAGAGCAGGAGCTACTATCGCAATTACTCCGTTTACACGTGAGCACCTCGCCTGTATGTGAGATTCCTGACAGTGGTTCGCAAGCGCAAA
CAGAATTGGAGTTGTTTGTAGCCGACTTCATCATTTCTCGAGCCCTAGTCATTACTGGGCTTGCAAGACAGATACCAAGCCACAGCGTTCTGGTAAGTAG
GCCATTCCTATTAAGATGGCGCATTACCTAGTGCTCTTCTAACGTTGCCGCGTTTGTTATTATGCCTCCTCTGTGCAGAGTGCCATTTCCCTTGTGCGAA
CATTCCTGTATCAATTGGATGTCGCCCCTCACACACCATTATGTCGATACTGGCGGTAAGAATCTGAATTCCTCAAATGAACGTACTTGTCCATGCTGGA
GAATCTAGCTGACGTGAATTGCATCGCTATATGTTCTAAACAGCACTCAGCTTACACAAGATGTGTTAGATCTCATAATCCACGAAAACTACCATGTCCG
TCGAATGGTGAGTCAATCTAAACTGTCTGACATTGACGCTGTCTTGTAACGCGGATAATCATGTGATTCATGTTTCGCTAGGCTATTTCATGCTTGCCGT
CACTAGACGTTCTGTCATGCATCACAGGGTTGTCTACAATCGGAATTTACGATACGAAAAACCATATCATCTCGTCAACGCTCGGCTACCTTTTTGCAAC
TCCAACACGGTGTTCCCGTGAAACCATGATGTCGTGGTTTATTGATGCTTGCCGGTTCGGGAGCGTTCGAGTCCATTTGATCTCTACTGAAACTCCCGTA
TCTCCTCATGAATGGAATAACTATGCAACCAACCTAGAGGGAAATGTGAAAGAAAGCATTCCAGCAGATGATAAGCGAAAAGAGCTGCAAGAAAGAATTC
TTTCGCTCTGCTTCGGTCCAAGAGGGTACGTATTCACACCTGTATTGTAGAGTCAGGTTTTATCCTAACGTTATCCATGTCGTTAATTTCCAGGTGGAGC
AAACGTATTCAAGTGGCGACAGCTCGAAGCGAAATTTTACGTGTCCTACTTCTCAAGATCTTTGGATCCCCTCGTGATCCGATGCTTTTGCGGATGCTGC
GTGAATTTGTGGCGTGCGGCTGGGTGGACCATAATGTATTTGGAGTTGTGGTAAAACTGATCTCCGCTCAAATGATGGTAACCATGGAGGCATACTGTAC
AACCGAATCATTGTGGGCAAAACTAATTCGTGTGACTGATACCATGGGTGTTACAGAATGTACCACGCTTGAGTGAAGAATTCTTGGACGACAATTCGGC
TTCCGCTGCAAAAACTATTGAGGGACTACTTTTTTGTCGACTTGCACCACTGTTAGTACTACGAATGCTTCCTCGACACGTCTTTGAAGGCAATCGTTTG
AAGCTGTTGGTACGTAGACCAGCAGACGAAGTGACATGCTACTTCCTTACTTCAGTTTGACATTTTCTGTGTGGTGTAGTGTGAGCGCGAGGATTTGGAC
CATCTCAATGAGTATATAGACCTTGAGCCGGCGTTCAACACAGAGGCAGTCTCTTTGGACACCACATTGGAAATTCTTTTTCACATCCTAGTCCGATGTG
TAGTGGATCCCCTAGAATTCAAGGAAGTCAAGATGCTAGCAGCAGAGTGTCTAGCTAAGTTCCCTCCACCCCTCGTGCTACCGCTTGTGCTTGCATACCT
AGTAGCGTTCTTGCGAGAAGCAACTCCACAAGACAAACGTGATAGCTCACTTATTGTGGACGAGGTCAGCGTTCCATATTCGTGTGGTTTGGTGACTGCC
AAGCTGATGGTGTACTACCTTAATCGGGTGTTTTCGGAGGATGAGTATGCCTACAAAGATTGTGATGTCACTTCAAGAACACTTGCTCTGTTGGTACAAA
TTCTGGGCATCCCGTCGGTACAAGGCTCCGATGAATCACTCCTTACCGACCTCCAACGTGGTTGCATTGACTGCATCGCATTGCTGGTCTCCCGATTGGC
AGTCAATGATAGTGAACAAGAAATTGTGAAGGTGAAAACAGCGAGTACTACTTCACTAATGAACCTTTTGATGACCTGGATTTTCGGAAACAAGAATGGT
GGTGGCAGTATTGAAGACTGTCATGCCGACGGTATCAACTCGCGAGTGCAAGAGTTACTCGAAAGTATGTGGAGTGAAGTTCGGTATGACCGCTTGCCAC
TGCAAGTTCGCATTTGTTGTTGCAATGTCCTACTCAGGTGGATTTCCTTACTGCTTCATGAATCTGTTCAGGCAAACCCTACCTGTTTCACTAACCACGA
TTTTTGCTGTGTATATGCAGTGCTATCTCACGATCGGAGAGTAGTACTCTTGCAAGTTGGAAATCGCAGGGGTTTATTTCACGAATTGCACTAGCTACCG
AGAGCAGTTCTGAAGAAAATGTGGTCGCTGGTGGCCTTCAGGTATACGTTATTTCTCGCACCATTCTTGTATGACTTGACTAACTTGTGGCGGCTGTAGA
TCATCTTTTCGTTCTTGTACAAGGCTAGTGAATCTCTCTGTGTGGAAGACAAAGACGATCTGCAAATTGTTCACACCTGTTTCAGGACTACAGTTTCTCG
TCTCGAGACTGCACGAAGCGAATTTGTTGCGATGAATGGACTAAAGGTCCTTGGGGCCCTCATCGGGAAGCTTTCGGCTTTCGTTGGAACTCTATCTCCC
GAAGACCTACAACGACTTATCGACAGGTAATGAATGACAAGCTTTCAAGCGCTTAATTGGATAAACTAACATGACCCTCTCGCAGGTGTTTGATCACAGT
GCGTGACCGTCAAATATCACCTGGAGTGAGCGAGCTAGCTCAATCACTGCTGCAAGCGATGACGCCTCCGTAGTAGGATACTAGCTCTAGAGTTTTGACT
CAATTAGATGACAATAAAAGGGTGGGGTTTGATGGCAACTAGAATAAGTGGATCGGAGACCGGAATTGACCGTCTATCTGCACGAGGATTTTGCTTAGCA
GGACGGTGGCGGTCGAGTGGCGGCGTAGTACAGTGCCCAGGCACGGCTGAGTCCATCGTCCATGGGACACGAAGATAGCACCTCGAAAGCCTTTTCGCGA
TCGATGACACTGTAGTTGGCGAACAATAGTGATGTCCAGCCAGACTGGTTCGCTCTCCAGTCATGCACGATAGGTAGCCTGCTCAGCACTTCATCCCATT
CCTCACGTACGAAGCGCGGTGGTCGGGATACTTCGAGAATCGGAGATACAGGGATCATTTGGATGCCATGAATGCACTCCTTGTTGGGGCTAAACCACGT
TGTGTAGTCGCACTTATTGTCAAAAAAGACACCCGTGACCTTGTTCTTCGCGAAATTAGCGGGGTGAACTGCAGGGCCATCATTTCGCAGCAAGAAATAG
GTGTTTACTGCACGCACGTAGACCTTGAGCATCAGTTTTGCTAGTGCCTGCTGTTCGGCGTTCTCCGTAACTTGGCCGTACAAAGCAATGCCATAGAGAA
AATTCACCTCCTCCGACGTAGACTCCTCATCCTTACCATCGGCCATCGGGGTCACGCCATGTGAGTATGAGTGGCCAAGCCACCAGTTGTAGTATCGGAA
GCGCGGGAAATATGGGTCGCTGCCGATAGGTGACGATGTGGCCACGTCGCGGATGAGAGTGTCAACAATCGTTCGAATCTTGACTGCATCTGCTGAATGA
CGCCAATTCGGATCCAAATAGAGGGCCATGGCAGCAGCGGTCACAATGTAGCCGTAGTGGTAGTGGTGATCATTGTATACACCATTACCAAAGTCAACAT
TCATGTCGTTCTTGACCAATGCTTCGCTTGAAATAATTCCCTTGTAAACCGTGTCGTATACTAGCGGGAACGCTGACTGATTATTCGCAAATTCTGACAG
CAATTGCTGCAGCTTGGAAACACCGTGCTGCGCCACATCTCTCATGTCTGGGTTGGTAGTATCTGCAAGTTGTCTTGCCACAAGACACATAGTGCCGAAC
TTCTGAAGAGCTTTACCCTTGAAGTAGTAGCTTCCTTCATGCGGTAGTGACCAGTCCCCGTAGATTTCGTCGGTAACAACGCGGCACAGACTCAGTCTGT
CAACCACTTCTCGCGTGAGGGAACCAGCGCGAGGCGGGTAAAACGCTGTACACACCTCCACACCCTGGCTTTCAGCCTGGGGTACGTGGCAAAGCCATGT
CGGGTTGGAATTCGGCGGAGTCGACAACATGTACGCGAACAATGGGCCATGAGTGTGCGACTGCAACACAAGCTCATGTTTCGCTTCAACAGTTGATGGA
TCCAACATCCCTTGTAGATGTGTGAGCGCAAAATGCAAGAATCGAGCCCCCGGATTGCTACCCGCAGCCGTCGCAAGCTGCCAGTGGAAAACGTACGACT
CCGAATTCAGCGTCTGGACATTAGCTCCTCTCGGGTAGACACCAGCACTTGCGTGGTAAAGTTGGAGAATCTTGTGGTCGTCCTGAGGTAGCCCAGGCTG
CACTGCACTGGTCGAGACGAACGCTGCTTGGACAACTCCTGTGAACTTTGAAGTGGTCGTGAGTTTATTGCCCTCAAATACCACCGAAGTGTTCCCTCCA
GCATTAGAGAAGAAATAGAGCACCCACTGTTGCCCATTGTTCAATGAAATCACGAAGCTGATCCCGTTTACTTGGTGACCTTCTCTCGCAGGAGCTCCAT
TGATAGCAACAATACTGTGCTCCGTGCCGAGTTGTACCTGCATATCCTGATACTCCACCGTCGTGAAGGCTGATCCCAAAGCTAAGTACGTCCTCATCCC
TGCCATGGATAGATGCACTCCCATGTCATCCCAAGATTGAATGGTTAGGGGCGGTGGACCTGATTGCCCTTGTAGCTCCACAGCTGAGAAGACCCAATTC
TTGATGGTAGGTGGGTAGAAATAGAAGCGAGGAGCTCCGTTATCATTGATGGGGCCGTCCGTCCGGTACTGCAGCAAGTAGCTGACTGAGAGTCCGCTGC
CAATGGTACCCGGTTGGCCCTGCACCACTTTGTAAGTATAAGGACCAGCAAAGATAGCGTCGCTGTCCCGTTGTCCGTCCCATGCCAGTAAGTTGCCCCA
CCACTCGTTGGTTGGAACGGGTCTCAATAGAGCTTCCGGGGACAGGAAATGGGGTGAAATGAGCCTTTGCAGGTCTCCTGTTGACCGAAAAACCGGCGGT
GGAGCTGGAGCTGATGTGGACGGAGCATTAGGTGGAGCAGGGGGGAATAGCGAGTACGACATGGCGAGTTCAGGGGGTCGAGGGAGATATCTTGGTTCGA
GGTGCGTGGCAGCTTCGAAAATGACAAGATACCTGAGATTGAAGAGGACAATGTCCGGATAATGGAAAATAACTTAAACTGAATATGCCCTATCCGGATA
ATGCTTGTCGCATGTTTGCGTGCGTAGGTTAGAAAAATCCGTTTTAAAAAAAGTCGAGCATTGTCTTAAAAAATATTTTAGATTTCTGATCCATGCATCG
ATGGCCATAGCCTTGAAAGAATTGGCTTTTCAGATCATCGGGATTAACGCAAAACAAGATCTAACAATTGTCAACATCGAAGTCGAAGTTGTGTCTTAGA
ACTCGTCAACTAGTATTTTAAATAACAGTTCTTTAGACAAGTCTAATCCTCATCCCGACAAAGCAGTCTCAATAGGAGCTGTAGTCCTTGGATTCTGGTC
AATGGTCGATTGTGCTTTGAACGGGCGACCCTGCTCTCAATTGCCTAATACAATCGGCGTCCTCATATGAATTTCCAGTTACGTGATGCCGCCCACATCT
TTCCTTCTTGTACAACTTGGTTATACGTATAGTACTCTAGACATGACGAGTTTTTCCTTACAAAGTTCGTTTATGCCGATGGAATCCAGGTTTTTGTCAT
CGATAAGATGAAAGCAGTTCTCTAGATAGTCTCTTCAGAGTCTTTCCGATACTTGGTATTCACGTCGACCCAGTGCAAGCTTGGAACACTCGAGATCAGC
ACGGTATTAATATGAGAGGCTCTATATTTGAACCACAATACTATCAACTCACGTCTTTGAGCTTTATACACATTCCTACATTTACCTCTCGGTGATTAGC
CCAGTTACTGTGACTTCGCTGATGCTACAGCTACAATGACCACCCAATCATCAACTACATGGCTATCGAAGTTTGCTCGCATGTGGGATTCTCTTCGAGT
AGAGCAGCACGGTTACTATTCACCTGAGCGGCTGATAGCTCTTCAGAAGTTCAGCGATACCGTTAATATTGTGGAGCTATCGGCAATTATCTTGATGACA
CCACTCCCTTGCCTATTTGTTGTTATTCTCGCAGATGTCACGCCATTGAATTCACCAGAAGCCGGCACGAACTCTAATGTCATTTTTTGGCTTCGCTCCT
GTTTGATTATAGGGCTGTACACAATGTCTTTTGTTGTGCAGTTTCGTGAGATGCTACCCGCGCTACCCATGTCTCGAGAACGCAGTTTTGGAATTACAGT
TTTTGTCTGCAGTGGCGTAATTTTGTTCGCCTACTCCATGTCCCTCCTTATCGGATTTCCAGTTCCTTTTCTAATGGTTATAGGGGCTCCCGTTTGGATG
GTGCTGATTTTGGGGTCTTTTGCAGTAAGCTGGAGAGATCATATTAGCGGCGACAGTGCATTGCAGACACAAATCGTAAATGGACTGAAACTGTTTGTGG
TTCAAATGTCGATGATCGCGGTCTATCCATTCTACATCTATATTTTCACGAGGCTATCGTCTGTTCAGCAGGCTTGGTTTTCACTTGTATTGCTGATCAT
TAAACTAGCAATCAAGAATGGTATTAGCCACAATATTCGATCCAATACCGACATGCAGCCAGAAATTGTCGTTTTCAACGTCGACGTTTTCAATGCACTC
TTTGTTTCATTCTCTATGCAAAACTCGACATCAAAGCTTACAGTCATCGTAATCATGACGGTTGATCTTGTACGAATGGCGAGTTCAATGCGTGAAGTGA
CACAGCTTGTTAGCGAGCTGAAGAAAATTGAAAGGCATATAAACTCTCTGAAACGTCTTCTTCAAGGTGACTTGGAATCAGCACAAAAACGGAGGAATCC
ACTGACCGACGCATGCAGTATAGTGGCCCGCCGTTCATTTGCCTCCAAGAATTATGATATCCGTCGATTACCAACCATAAAGGGTCCGCAACTTCAGTTC
AGATCCCTACATGTCTTATTTGGATCTAATCAAGTTTTACCGCGCGAGAGTCTTGGTCAGCTTGCAAAGTATAATTCAAAGACATCAAATACACAAGAGA
CCCGAAGACCTGAGACTTCACAGTTTGACAGCAAACGTTTTAAATCTTCTTCTGATCCGCAAGCAAAGTTGGTTTTCATGGAGAAGCTATACGCGAGAAA
GGTGCTAAATCTTTTACATCTTACTGAGTTTACGATTCTCATCGAATACATCGAAGTGATCGTACCAGTTGTCTACTGTAAGTCTTAAGTGTTTGTTGGA
CCCCCTATACTGAAGTAACTTACTGTTTATGTGCCCCTGTACAGCCATCTACGTCGTGGCCATGTCATATTTGCCAAACCGCGTGTATTATGCGCAACTT
GCATACATGGATGTTGACAAACTTCAAAGCACGCTATCTAATGTGCTTCTGTACAGCTTTCTCGAGTTTCTGTCGCTCATTTTCCTGACGACATTTCTTC
GAAAGGCGATGGAATACTCACCTGTCCACCAGTTGGCGTTCGTACTTCGGACTCAATGGAAAATGGTGCAATCGAAGTTGATATTGTGGGTGGTTTACGT
CGTTCAGTCCTCACTCGCACATTTTGGTACGTCAAAAATTGTTATGGTTGCTTGGGATTCTACACCTGATGTCGATGCCAATGTCTTCCAGGTGCCGATT
ACAGTTTTCAATTTGCATGGCTAAAAAATGAAAGTGACAAGAAGTAGCTCATGAACTATGTCCAGAGTCTCTTGTAGAGGGGATTGGTATTTCCCTATAG
AGAGGAGCATACAAGCTTGAAATCCCATTTCGGATCGATGGTAGTGCTGGACCACAACGAGCTGGATCGCACACTGTGGGGTCCAGCGACGACAGCCGGC
CGTTCACGAGGCACGGACATGATGATCTACATTCAGCTGGTAGTACATAGTACTCTGTATTGGCTATTGGATAGAATTACTGGTTTACATTGCAAATACA
TGAGTGCAGGTTGTGGCTGGGCTGCTTGGGGTGACGTGCGCTCTGGATTACGAGAAGCCAGAGGCGGTGCGGTTAGTTGCAGCAGCGGCGACGTTATTGA
TGTATTTTCGCAGCACTGCACTGGTATGCCTCTATTCAACCATTCAAAGCTATCAACACGAAATTGACACTGCACAGTTTGTCCGCTTGATGCTGTTTAT
GTCTGCATTAGTTCTCTATGGCGACATCATCGTTCCGATCCTTCGTCTCGCTAGAGATGGGAGTGTGCTGCCACTGCCCACCACCAAGCTAGTTCTACAC
TGCATCTGGGTGTGCAACACGGTGAGCGCCTCTGGTTCATATGCCGATGTCTGCACTGATTCACTAACTGAAGTTGTATTATTTGTATTCGATGTGCCAG
CTCCGCGTATTGTACACAATCTTCCGATTAGGAACGCACACGTCTGGTGGGAGGAAGAAGCGTCCGATGTCGAGCGCATACAGAATGCGGACGAAGGTTG
CGTAAGTCAAACATAACTAGCCGATAGACTTCGTTCCAGGATTGATGTCGATGAAACCCCTCATAGCCTGTGATTGACATTAAAAGAGCATGTCTGATGA
GGAGGACGGCTGCGTCCAACAGGGATGCTAATGCTACGCACCCCTGGTTTTGGCTTTGGCAGATGCTGCATACCCCTGGTTTTGGAAAATAGCGTAATTG
GGCTTGATTGGTCAAATTTGTAGCGAATAGAAAGGCTTCATCAAGTAGTCACTGACAATCACTCTCAATTCCGCATTTCCACCAAGTTGCGCACACTTGG
TTGAGGACGATGCGGGGCGTGCTGTCCCTCTATCCGCTGTACGTGGACCCAGCAGACGCAGCGGCAGCGGATGCAAGTGAAACGCTGCATCCTGTGACTT
CAGAGCCAGCGGCAGGAACTGAGTCTTTCAACCCGCAACGGTTGGCAGCGCTCATTCGATCCACAACTGACAGACTCGGGTTCGACTTATTAGAAATGTT
ATGTGATATAACATTATAACAGCTAATTTATTACAATATTCATGTGGACGACTCATTGATGCTGCAGGCTTACTAGCGAGACGACAGAGATTGACGCTGA
TGTGTTGAACTCGTTGCCCAAATGGGCACAGGCAGTGGTGCAGACAGGATGCTTCAATGGCAAGTTTATTATTTAGTAATGGTGTTACCTGTGAGCTAAC
GACTGGCTTAATGGCTGCGTGTGGTGCTAGATGTTGGGATGAAACCACCTCTTAGAAACAAGTTAAAGCGAAGCTTGAGACAGCAGAGTGACTTCAGGCG
ACAAAGGAAGAGACGATCGTTTGGCAGTACCGAGGATTCGATGGAAGACGAGTCTAGTGAACTGCAGGATTGTTTGGATGAATTAAATGATAATCCTGAG
GAGGACTCGGCGATGGAAGACGTGGAAATTGAAGAGCTGCCGACGTTCTCCACCCAGGCGGAGATTAAGGCGGACAGCGTTGAAAAGTACGAGGAATTGT
TGGAGAAATTGATTGATGTGGCAACAGAGCGCCAGCAACTGGAGAGTTTCGAACAAGATGATATGGATGTGTTTCACTCCAAAGAAGTGAAAATTTTACG
GCAGTCACTGAAAGCCATAGAAAAGAACGATTGGATGAACAAGCTGAAACCAGAATTGTTGATCTCATTGATGAGTGCATTCGATGCGCAGGTGCGGGTG
GGTTTAACAGTAGATGTGTTCGGGGCTGAATCTCCAACGAAAGATAAAGAGAGATTGCAGTTTGATGAACGACTGGTTTTGAGCCTCTTAGCGTCGCTTG
ATGTCGCGATTTGCGAGCTGACTATTATGACCACGCCTCAGATCGATCGCCGAGTTCTTTCCGAGGAGACTATCGATAACTGCTTTCAACTCTTGCACCA
TGTGATGCGACGTGTGTTGCTTCCATGCATTGACACTTCATATATGACGACTGCATTCACTCCGAAAGAAGGAAATCGGCGAGAATCAACTGGAGGAAAA
ACTACCAGCTCCTATCGCGTTAATTTACGCGCAAACAAACGCGCCCAAAAGGCCATCGAGCGAGTTTCGCATCTAGCTTGCGACTTCCTGGATAAACTTT
CTACACTGGTCTTGAGTGTAAAGCTTGCGGATCGATGGATAATGCGCTTGTCTTCGTCCATGGTGGAGCTGTTTTCTCTAGAGCACAGTTCGTATGCCAC
ATCGTTACAACAGAGCGCGCTAGGCATCTTGCGAGCTATATTCCTGCAGTATAAACCCCATCGGGAACCATTGCTTGGAGATATAGTGGATGTGATGTTG
AAGCTACCTACCTCCAAACGCACTCTTAGAACAGTGAAGTTGCAGAATTCAAGCGACATGGTGCAACGTATAACCACAGTAGTGGTATCGATAATTCAAT
CTTGCTCAGCTGCTGGCAAATTTAGGAAAATGGAACCTGAGGTTGACTCGTTAAAAGATTCAGTTGAGCCATCATCAACACCGGATACTGTTGCTGAAGA
AGTGCCTTTGCAGAATAATGGCATGGTTGTGTCTACACTGGAAGACACAAGGAGCAATGCGAAAGAATTTGTTCGGATGCTGCTAAAGGCATGCTGGAAG
AAAACCGAAGACCGTGATAATCGCGTGGTCGTAGATAACTTCGTGGAAGACCTCCTCGTTATGTTTGTGCGTCCAGAATGGATTGGTGCGGAAGAGCTTT
TGGTGGTGTTGAGCTCCTCACTAGCAAGCATTTTACACGCAAACATTTCAGCGGATTTGAAAAAACCGGACTCTCATCATACTTTTGCAGCACTCAGCTC
GATCGGGCAAATATGCACGACAATTAAGCAGTATCAAAGACGGGTTGATCAGAACGACTTGGATGATGACATTGACGATAATGTCGTCATTGAAGAGCAT
ATAGATTGTCTGCGTGAAGCTTTTACTGGTAAGAAAACACGTTCCAGAAGTCAGCAGCCAAGCGATGGGATTGAGTTGTTTCATCAGATAGCGCTGAAAC
ATATTGTTGTGATGTATCTCCAACGACACAACTATCATCAAAGCGACTCAAAGAAACTACTTATTTTGAAGTTTATTTCGGAGTCAGAGGCTCATTTGGG
TGTAGCAGGGTCGAGTTTTGTGGAACAAGAAAAAAAGTTGTGGGAATCGTTATGTGGGGTGCGCTTGGGAGGTATAAGCTCAACGTTTAAGATGGATACC
CCCTCAAGCGAGTTAGCTTTGAAAGCGAGTTTGCACCTTGCTGTGAAACGTGAATTCTGTGGTTTGTTCGACAATTTACTAGCGCATATCATGGCTTTGC
TTTCTAAAGGAATGCCAAGTCTAAGAGCGCGAGTTATGAAATGTCTTCGCGGGATCGTCGACGTTGATCCAATGCTGATGGCAGAAACTGGTGTGCAGTT
AGCAGTTGAAAGGTGTTGCTCGGATGAAAAACCCTCAGTTCGTGAAGCAGCAGTGGATTTGATTGGAACTTATGTATTACTACAGCCCTTCTTGGTACGT
ACCTTTTTCTTACTGATGGGTTATACTTATAATATTCTTAACTTACTGAATTATGGACAGTTTGATAAATACTTCGACGTGCTTGCTGGAAGGATACGCG
ACAAGGGTATCAAAGTCCGAAAAAGTGTGTGCAGGATTTTCAAGAAAGCATTGGTTGCTATGCAAGAGGGGGCCAATGATACAATTACGGAACAAGAGCT
TCGCCGTAAGAGTGCTTGCATGAAATGTCTGGTTGAACGAATTGGACATGCGGCTGAAGATCAAGGTATCAAGAACTTCATCATCGATACTTTTCAAGAA
GTATGGTTTGGTGCCGATCTTTCTTCTTCCAGGCTATCCAATCCATTAAGTGAATTTGGTGATGGCAATACTCTACCACCTGGTTGGTCTGCTGTTGTAA
CGAAAGTCGATGAAAATCCTGATTCCACTTCGCTCTCGGAGCCAGGTACAAAGTTTGTTTCCGAAGACGGGAGTGTCGCCAAGTCTATAGAAGAAGCTTG
GTCTTCGTACCGAACACCGATGGTGACACCAGCCAGCCTAGTAAAGAACAGCGACTCCAAGCTGGACAATAGTCTTGAAGTTGTCACAACCATCATTGAG
GTAATTTACGGCGTCCCAAACCTTGGATGGTTTTCTGAGCTTTTAAAACGACTGTTGACGGAACGCAATAGTAGTTCTACCAAAAGAAGGATGGCGGCAC
AATCCACTAAAAATCGGTCGGATCAAGTTGCTATCGCCGAAGATCGCTCTGAAAAGATCATTGATCGTCTTGTGGAATGCCTTATGGCCTTACAAGAAGG
CACACATTTCAATGGTGTTTCAATAGGAAATGCGCACCAGCAGTTTGTGACGTGTATGACAGCTCTGTCTGCCTTTTGCGAAGCAAAGCCCCAACTTTTG
ACTCGTCATCTCAACACAATTCGCGTATACCTGAAAGAAGAGGATGTTAAGGTCCAAAGTTTATCTGTCTCCATGATAAACAATATCATAGGCGTGAGAC
GAATTCCACAGACTGTTGCTGGTACACTAGAAGACGATTTGGAACTCCTAGTGATGTACTCTCCCCCAAGTGTTGTTGGCCCGAGTATCCAGTGTCTCGC
AACACTATCGACAACAAGGAACAAAGGACCGGTACGATTGCTTCGGTTATTAGAACGCTTTTTCCTCGCTATCCAGGGGTACAAACAAAGAGCATCACTC
GTCGATTTGTCGGACAAAGATAATTACGTGCTTCAGCGTGCATTGTTTGCAGCGGGGAAAATTGTTGGTGCAACAGACATCGACAATCATCCAGAACTGG
CAGAAGAAGCCAAGACGGTGGAGATCGGGACGATAACAGAATCGTTGTACAAGTTATACGTGCATTTTGTCCGCAAGCCAGGCAACGATAGCTGCGTTGC
TAAAGCTGTACAAGGTATGGGATTTTTATTCCCTATACGGCCACGGCTGTTTCTCCAGGCACAGCAAGATGACTTGCTAAATTTTCTTTTGACGGCAAAT
GTCCGGGATACTGGAAAGGCGAAACTACAATGTCTTGTAAGCATGAAGGAGTTGTTGCACTTCGAGGAGCAGCGTTTGGAAAACGGTCTTGCAACAAGGA
CGATGAACCGATCGAAGAGTAAGGAGGAGCAAGTTCAAGGCGACCAAGAAGCTGACGCCTCATTGATCGGTAACGTAATGCAAGCAGAACTGGGACATAT
CTTGCTGTTATCGCAACAGAAAGTACCACAGATTCGGAAGGAAGCCGTCGCATGCATCGGCGCATTGATTACGCAAGGTTTGGTTAATCCATTGCAATGC
ATTCCAAACTTGGTAGCACTGGAGACAGATCGTGTCCATGAAGTTCGAGATGCAGCATTCTCTCAGCTGTTGGAGCTATACGAAAAGATGCCGAGTGAAT
TCCACACACCATCGGTTAAAGGTATCAAGGACTCTTACTCATTCCAGCTCAGTATTTATGGCAATGCTACGGCACTGGGAGTCGACGAAAACAAAAAAGA
CTTTTGCCTCTTTGGACGGCTTTACAGGAAATTCCTCAAGTGGACAAAATCGCGCGAGCCACCTTTTCTAAAAGCACTGGTAAAACAGTTCACCGACCAG
GGGTGCGTGTTGAAGTTATTCAAAGGCATGCCAACCACCGCTAACAACAGCAAGGCCTTCACGAGCGTTTTAAAATATTTGTGCTATCTGGCGCAAATTA
TTTCGACACTGCCGTACATCGTGGAGGACGAACTGCTGTACATTATTTATTCGATTAACCGCTATGTGAGTCTTCGCCTCGGGTACGTGCCTACCATTCC
TCAGCTAGGTATGAATAAATATGCGTGCTGACATTTTTTCTGTAGCCCTGTAATGGATGATCTCAGGACAGCCTTTGCCAAGGCGGGTGTAGCACCGGAA
CTACTGGAGGATGATGAATCGAATCTCTCTACGTTATGCATCAATGAGTATCAGTCATTGCGTCAACTTACTGAGCAAGAAGTGGTGGTGCTTCAGACAA
ACGGGAGTGTTGCTTTCGCTATTGGACTGATGCTCCGCCTGAAGTTTGCACTCAAACGCAACTACCAGCTCGACAATGAAAAATGCGCTACGTACAAACC
ATCTACCCCAGATTCTCCAGTAGAGGCAAAGGAACGGTCTCCCAAGAAGCTTTTGCTGCCCTCAGTCGACGATTTGTGCCAAACCGACGACCCAATCAAG
CTGAGCTGGAACTTGTTCATGGTTGCATGGCACGCAGCTCGCGAGGACCAGAGACAATTGGATGTCGATCTAGAAGAAGCCCAAACGCCAAAACCCACAC
CAAAGCGACGACGCCGTTCGCGCAAAGTAGTCGCGCCTAAGACCCAAGTGTCGGAGGACGGTAGCGACGATGACGACGAGTACTTCGAAGGTTTTGCTTA
ACAGCCGTTCTTTCGGCCGAGTTTTGAATATTATCTGCGAGTATTGAACTTTTCATCTTCGTCTGCAATACTCTTCATCATGCCCACTCTTCAGCAAATG
GAGACTCGACATCGACCCATCGGCAGTCATTCTCCGCCGCTTCACGTCCAATGCGCGAAGGAAAACAACTTCAAATTCCGTAAGTGATGCATTGTACAGA
GTATCCAACGTCACCACAGGATCCACCAGCTCCAGTCCGTCATGAAACAACTCGAGCATCATGCTAAAACACCAGAACCGTTCTGCTTCGTGTGTCAACA
CTTCACACACCACTCGCGCCACACCCAGCAGGAAGTTGGGGTCGTCCATCCCACACAGCAACGGTGCATCACTCGCAGCTATTTCTCTCCAATAAGTGCG
ATGCAAGTGCACCAGTCTCTTCAGATCCTGCAGCGAGGGTATTGCCTTCTCTTGCACTCCGTCCTCTTCCGCCAGAAGCTCGATAAAGTCATAGTATCCC
CCTCTTCCTTCATCACCATCCGCCACGTCTTTAGCCTGAAGAACTTGAGCAGCTCCCACCACGTCCTCAAACATCGCACGTCGCTCCTTCAACGCAAAAC
TCCAAATCCCCGGATACGGGGGTCGAGTTCCCGTCAGTAGTAACCAAATCCTCGCTCGAAATTGCGGTGCAATCCCCAATTCCAGCGCTAACTTGAGCAG
CTGTGGCACATTCACTGCTCTCTCACTAAGCAGCGCAGCAAACGAAGCTTCCACATCCACAATATGTTGCACCACAGGCACGCCCAGCGTCTTGTAGTAC
GTCGTCCGGAAGTTCCGATTGAGCGCCATAATTCAACCCGTTCGATTGTTTACATTTTTGCTAGTGAATTTCCATGTTAATAATTCAATTTACATTTTCG
GTAGTGGATTTTCGTTTTAGGTAGTGAACTTTACATTTTGGTAGTGCAATTTACATTTTTGGTAGTGAATTTACATTTTTATGTGATCGAAACAACTTCA
ACGCGTTTTTCCACAGTTTTTCTCCAAGATCTAATTCGTCTTCGTGGAGGAAGAGTGATGGTCGTGTCCAAGCGCCAGTGGCTCGGGCCGCCCAGCAAGA
GCAGACGGAAGCAGCACCCGCGTTTGCTGCAGTGTCGAGCTAGCGAAGGTTCTGCGGGTGAGACGGACTGCGAGAGCCTCGACGACGTGGACATGGAGAG
TCCTAGTGGATCCAAGACGTTTCATAGCGACATCCAGGCGCTACCAGATGAATTGCTGGCTCTAGCGCTAGCACAGTTGGATGGACACTCGCTGTTGGCT
TGTGCTGCAACGTGTAGAGCCTTCCGGACGTTGACATTCGATCGGGAGGTCTGGAAGCGACTTTGTGTCAAACAGTGGCCTACACTGAGGACACAAGTGC
TACCGCAACTACCGGGTGCGCCGGACTATGATGTACGGGTGAAATACTGTCTTTTGAGGGCTTAAAGAATTGTGAGAGAGATGTAGAAGCTGAATTATGG
ATATGTTTGTGTTGTGACTTTTGTGTAGTTGGTGAGGCTTTATGGAGGAAGCTGGAGACGCTGCTTTGTGGAAAAACATACCAAAGAACAACGAACAGAG
ATATCAGTCAAAGTATCAAAGTTTTCCGATGTGGAAGCTATGAGAGATGTGGATAAAGTGGTGTCAGAGACGTTCAACATTGGTGCACACCGCTTCTGCC
TCTGGGTCTTTCCTAATGGCAACCCCAATGAGGCTCAGTACAAGGGTCGAGTGCTCAGTGTGTACCTCGTACTCACAGATTTATCACGGCGGCCGCCGGA
CTGGCTCACGTGCACCGTGTTCTCGTTGCAGGTGGAAAATGCACTGGATCCACGACGTCGACTCGAGTGGCATTCGTGTCTGACAGACAACAAATTTCAC
AAACATCTTAATAATTGGGGCGTGCACTCGCTTGGATCGCTTAATACGCTGCGAGACCCTCAGCAAGGTTTCCTTACTAGCTCGACTGAGAGTCAAACAC
AGCCTGATACACTCACCGTGTCGGCTCAGGTACGGCTGATGTCGATTACATTTCGTGTAGTTTTTGAACACGATCTTCGAGAACACCATCAGCTGGGTCT
CGTAGATTTTTCGAATGTGGCAGAATTGGAGCTACCTTTCTGCTGCTCGTTACGTGACTTGCTCGTTGCGCTCCATGATCAATTTCCCGAAGTGCTCGGA
GAATACAGAGAAGAGGATGCAGCTATGAACAAGACTAGAGTGTGGTGCTTCAATCAGCCAGTGGTGTCAGGTCAGGCGCTTCGACCGCGTAAATTGCTCA
CGTGCGACAAATCTCAACATGAACGGCCGCTCTTTGGAAATTTGCTCTGTGATGGGGTAGACATTGACGCATACTCGTTCTGCCAGATATACGTTGAAAA
CAACTCGGCGACGGATGACCTTCCTCTTGATCTACCCTCTGGTGGCCAGCCAACTGCGAAGGATTTATCAACGACACCGGAAGGATATGTTTTTGTGAAA
CTATTGCAGTTCACACCGGTCAATCGTTTACAATACTTGGGTAAAGTTCGTGTACTTCAAACATCATCACCCGAAGACATGGATATGCAGAACAAGCATG
AAAATGGCTATGTGGCACCCAGCGAATTGTACGAGGCTGTTGCACGTCATACAGGTTGGAGCTGTGCGCAACTGGAAATGTACAGAGAAGAAATCGCCCC
AATTATTCTTTCCGAGTTGATTCCGTATGATGCATTTTCTCAAAGTGCAAGATTGCAACCAGCAGATACAGTCATATTTTGCATGCGGCCACAAGTTCTT
CACGGGGTTGCACCAGCACGTGCTATCGATTCTGTGTACGAGCTGCTGCTTGAGCGATATGCTGAGGCTCGCGAACTCTTTAATCCTAATGGATTGGTGG
CACCCACGCTAGAACAGGTTGAAAACTTGGCCGAGAAATTGGACATTCCGAAATTCCGTGTACGCAGTGCATTCCGCAAGTGCCATGAAGACGCACTTGT
TACATTGCGCTACATCATGGAAGGCCGTCACCTGGGGTTTATCTGTGACTCCTGTGGCGAAACAGACTTTACTGGAGCACGGTTTAACTGCGCTGTCTGC
AGCGACTACGATTTATGTGCTGCGTGCAATGGTGAGTGATGATGTTTGAAATGCTCATTTCTGGATCTGCTTGTCAGGGCTAACAACTCTGTGTTTTGGT
CTTGAAAGCAGCGCAATCCTGCGAGATCTCACACCGCTATGCCAACGTTGACGGTAAGTGGCAGCGCGTGTACAATTTCAAGGACCATAAAACCATGCAC
ACCATGCGCAAAATGTTGCCGGTTTTTTATGGGTACGATCGCAAGTACCAGTGGCAGCAAACAACTGAGGGTTGTCGATTCAATCACTGAAGTGACACTT
TCATGTGAACAAACAGATACCTGGTGTGCTAATCTCATGTAATCTTTAGGTTCATTCATTTTCTTACAACGTACTTTGCGTCTCCCAGCGAACAACTCGA
CTCGGATCGGCTCCATACCTGTATCAAGTCTAAATTAGAAACAAAATATCATCGCATGTACTCACTGGATGGTGGTGCCCACCTGCTTTCTCCTTGTACT
GGACATGAGCGCGTAGTATGACCATGGTGCATTGGCAATGGGCCAAATTTCCGTGCGCTCTAGATACAACCAGTGTCGAAATCCGTGCTGTCGCGGGCAA
CGAGGCCGAATTCAGGATAGTGCTGATCTGCCGCTGACTGGGACTCGCGCTCGATTCTAGTAACATCCAATGCCCAACCCAAGATGCAAGAGAAAATCAG
GGATCCCAATGATGACCCAGTAGACCAATTCCACGTCCATCGCTGCTTCAATGCCTTCCTCGTACGTACCCTTCACTGTGTCGCGTCTCCGATCGTCGTC
CTGACCTGCGCTTCTCCCGTTTGCTGCTTGACTCACGTGACAATGACGCCGGCTCCTCCGTCCTTGTGTAGGAGAAGCCCTGGAATTCGTTCTTTGGCGA
CACGGCGAGACGCTTGTCCTGCTGCAAGAAACCATGGTCAGGCAACTCCTTCGTAAACTCACGGTCGAAGTTCTGGATGTCCGTCGGGCTGCGCACGCGC
GGCTTGAAAGGAGGCTTAATGCCGCGCTGTTCCAATAACTGCCAGTCGATAGTAGCGAAAAATACGTGGTTCTTGATGTCCTCCACGCCAGCACCGGGGC
GCGAGCCAATTCGGTACGTCGGGTCGCGCTCCAGCAACGCTGAAATGAGACTCTTGACTTCAGAGCTCAAGCCGAAATGCGCAGGGAACTTTAGCGGTGA
CTTCATGATTTTAGTGCACATCTGTTCAATGTTGCGGTCGAAGAAAGGTGGCCAGCCCGTGAGCATCTCGTACATCAGCGTACCAAGACTCCACCAGTCA
ATGGCCTTGCCGTACTCTGTCTTCTTCTTGCGACTGATGAGCATCTCTGGTGCCAAGTATTCAGGTGTACCGCAAAAAGTCTTGGCACCTGTAAAGTCCG
TGCAGTCTGTTTTGGAGAGACCAAAATCGGTCAGTCGCACGTGGCCCGTCTCGTCTAGAAGAATGTTCTCAGGCTTGAGGTCCCGGTAAATGATATCCCG
CTCATGCAAGTGGCCAATAGCCGCCACCAGCTCCGCGGCGTAAAAGCGCACCATGGCCTCGGAGAAAGAGCGAAATTTCTTCAAGTGGAAGAAAATCTCA
CCACCGCAACAATAGTCCGACACCATCACGAGCTTGCTAGCGGTCTGGAACGAGTACTTGAGCCCGACAATGAAGGGGTGGTCAATGGAGCTCATGATCT
TGCGCTCCATCATAGTGTGCCCCACCTGATTGCGCTTTACCAGCTCCGATTTACGCAATACCTTCATCGCGTAAATCTTTCCGTCTGTTCCACGTTCTCT
GGCCATATAAACCTTTCCAAACGATCCCTTTCCAAGCATTTTAAGGATCTCAAAATCCTGCATAGTCACCATGTGTCCTCCAGCATCCTCCCCAAAACTG
TTGCTTCCACTGAGCCGCGAAGACGAAGCGAGGGCAGAAGTCGATTGCACGTTTTTCGGTGCCGTAACCGTATCCACACCACGCGTCACTCCGTCGGTGC
TGTTGCCATCCTCCTCTTCACTCTCCAGCGAGCTGCTTCCCGTGTTTAGGAACTGCACAACCTCAACTGGTCGTGGTCGCAACGTCAGAACTGCATTCAT
GTATGTTTCAATAGCTTCACGGCGCTGTTCAATGACACGCAGTGACAACGACATGAAGAATTTCTTCGGTGGGAAATAGAGCTTTCCAACCGTAGCATAT
TTCCTCCTCAGCGTCTTGTGCAGTTCCCTGAAGTGGCTGTATCTCTTCTCCGAGACTCGAATAGCTCCTGATTGGAAGTGCACGTACACTTGAAACACTG
TATACCGCTTCTTACTGCCGCTATCCCTGTCTCTTCCCAATACAAGAGCTCCCATAGATCCTCCATGTCCTCCTCGTCCATCTTTTCCATTCCACGTCGA
TGATCTGCCAGCTCCACTGGCCACAGGTGAATTTCCAGCACTATCAGCACCTGCAGGAATATGCAGTCTATCTGCTCTGTCCGTCGTGAGTTTGGACTTC
CAGCGTGGAATCTCCACCTTGAGGATATCGTCGCCTGCAGGGGGTACCGCTGGGTACTCTGGATGCAGCTGGTGTTGCGGACTGATCTCTCTACTGGTTG
TATGAAGACTGAGGAAGTTGGAGCTGCGCTGAGGCGGCGATAACGCCGAGTTGGACGTGTAGGACGACGCACTGGAGCGTCCTGAAGCCGGCGCATCGCT
CTGCACGTGTGTGAGCGAGTGGCGCATCTGTGAACTCTTCTTGCTGTTGCTGTGGCGCTTCTTGTGCGTCTGTGGGTCTTGATACGACGCTCGGGCGCTC
GCGCCTGGTCGCATTTGAACCTGGTGCTGGAACGTGGAGCTGAGGCTGCCGGACGAGCGGTCCATGGGCGGACGGCGCGGGTACTCGTCGACTGCAGGCA
TCCGGAGAAGGAACGCCGGTCGTCGAGTGCAGGGGGTTTAGAGTTGTGTGGAAGTCCGGCTGTCTCTTGCTCTCTCGTCGCTTTGTGCGCGAAATTTGCA
GTAGAAAGACTGGAAGTGAGTATGTCATACTGAATGCAAGTGAAACGTGACAAAGAAGTGTAGCTGGCTCTACAGTATCAAGATAGTTCGATTGGAATAA
TCACCAAAGTCGATGAAACGCATGACTACAACATGCCAAGATGGCAACAGTGGGCATCTCTCGCATAGCTGTGCTGGGTTTTCATCGAGACTTCTTCTTG
CGTGGATGGAAGCACACGTTCTTTTCTCGCCACAAATTGATCGAATCGTGTCAAGTGAAGAAGGTGTCAGGTATGGCCCCCAAGGCCCATCAACGTGGTG
GACTGCACTGGCGTCAACTCATTTCAATTCAGCTCCGCCGAGAACGTAGTCTTCATGATCGTGGTCATTGCAAGCTCAGCACCAAGTCCACCACGCTACT
GCAGTATTGCAGCCTGTGATGCTCCGAATAAGATCCTGTTTGACAAGAAACGGCGGTGCGTCATCAGGATTTGGCCGCAGTTTCAAGTCCAGTGACGTCA
GTGGGCTGATCCTGATTCAGCAGCACCATTTGGTCATCGACGCCACGGCTCATTGTGCAAATTGCGCCCGTGCAAAAATTCCAGCTCCGAAGCAGTTGGC
AACGGCGAGGCGAGCGGCAGACACCGGTTTCTCGACGACCAAGCCTAGAAAGCTGCGGTGCTGGCCGTTGCTGGCGCGGCAGACGGCCGAGCAAGAGCCA
TCCACGCCGCCAGCTTGCGCATCGCGATGTCAAGATTCGGGCACACGGACTGAATGAAGCCTTCGATAGCCTCCAGAGACGGGTCGTCCTGCTGCAAAAG
CCAAGGCAGAAACATAGGGGTGAATAGTCATCGTTTCGGTGGCATGGGCTCACTAAATCTTACCATGCTCTCGATGAGATAGAGCGCGATGTCACCCTTG
AAATCCACAAAGGCCAGTCTCGCGAAGAGCTCCTCTGGCGAACGACCGAAAGCAGAGCCCGGCAAGATGGCCACGCCGGTATCCTGCAACAGCTGTGCGC
ACAGCTGCTCGTCAGTCGAAATGCCTCTCAACGCGAGAGCCTGGCGGTGTCGTCGGAAGCATGGAAACAGATAGAAGCCGGCTTCGGGGACCTGGACCTC
GACATCCATTTTCTGCAGTTGGTAAGCAAACCAGCGACCAATTAGCTGCAACGTTTTCTGGCACTTGCGCTTGTACACGTCAAGCTCGACACAACTACAG
AGAGTAGAACACAAAAATCACAGGAAGGTGAGACGTTACGTCGATATCTGAGGTTGCCTGCTCGCGGATATGGAGATCATACGACGTACTTGAGAACAAA
CGCTCGTCGAGCGGCATGCTGGATAGGCGAAGCAACTGACGTGTACGTCTCGGACGCCATGACGAGCATGCTGCTGCGCAACCAGTCCATGCTGGGTGGA
AACAACCAAAAACCCATGCGCCAGCCACCGGCGCCGCACCACTTGCTCAATCCTCCTGAAACGATGGTTCCTTCGGGGTAGTATTTGGAAAGGGAGAGGT
GTGTGCCTGAGTGGTGTAGTTCCGAGTAGATTTCGTCCGAAACCACGAGAATCCGGTATTTCCTTGCAATCTTTGCAAGCGCTTCCAGCTAGTATACAAT
TATCGTTGAACACAACATCAAGAGCAATATTAGACCGGTGAGTTTACGCTGCACGAGGTAAGTCAGCAGTCACAAACCTCATCGGGTTGGTATGCGCAGC
CAGTAGGATTGGACGGACTGTTTAGAATGAGAATCCGAGGAGCATCTGAAACCAAATTCCAGCAATATAACATGGTGTTAGCAAAATACCAGCCACATCA
AATGAGATCATTCCTCGTACCTGGGTCTTTTGCGCAGTGGGCTTCCAGCACTTCTGGACGAAGCACAAAGTGGTCTTCAGCATGAGTGGGTAACCACATC
ATATTTCTTTGCGCGTAATAAAATTATAAAACAAATCAGATTGCTGTACTACAACAACAGGATTAATCAACGCACCTTCCAGCAATAGCGGCTTGTGGAG
CGTAACTTGTGCAACTCGGGTTAGGCAGCAGTAGGTCTCCATAGTACACCGTCTGCAGTACAAACAGCAGCTCTTTGGTGCCAGGTCCCACCAAAACATC
GTCTCGCGAGTAATTAATATGCAATCGATCCGTTCCCCATGCAGCAATATCGTCACAAAGTTCCGGTAGTCCCGCGACTGGCAAATAATCTCTCTGGTGT
GAGTTTGCCCTATCATCAAAACGCCCATCAGCTTCAACGTATATCACCAATAACTCCCAATCTTAACTTTCGCTCATTGAGCGACTCACCGCAGCTCATC
GATAATGCACTGCGGGATCGGGAATGGCGACTGCCCCAATCCCAACTTGTAAATGCATTTCCCCTCTCTAATCATCTTGTTACTCAGTTCGTCCAACGCG
CTGCCAGCCGCCGTACACAGCATCCGAACCTTGCAGTTAATCACCTTCCTCGGTCCTAAACCACGCACCAAACCGCTGTCAAACCTTTATTTACCACTAT
TCCATACAATCATTATCCACCTTGGTAGGGCGTCTCAAGATGACTCGCTGATCGTTTGTGGCCTGTAATTGTATCTGATTCTTGCCTCTCCGTATTACTC
TCCGCTGTGTCCTCATTGCTCGTGTCGCTCTGAGCATTGACGTCAATAACTGGAGCTGATTCCTGTTTGACTGGAGCTGCCTCAACGGCAGTAGATCCCG
ACGCTTCTGACGCACGCCGCTGCACCCGACGTTGCAGCGTAGTGCGAGGCACATCGAACTTGCGTGCAGCCTCCCGCAGAGCCATGGAGCCGCTCTGCAC
AGCGGCAATGGCCGCCTCAATCTGCGCCGACTCGGTCGCCTGCCTTGCCATATTTTCCTCAAATGGAGTGGAATCAGATATTATCAGATATTATCAGATA
CTTATTGAAGTGAGCTAAGGTTCAGTGGATAATTGTCAACGGACGTCTCATGGCGTGGCGAGCGAATAATGCGCGGGGCCGTGGGGCGCCTGCTGCGACG
CCGCGCGCCAAGCCGACGATGCAAGCGATAGCTGAAATTGAGAAGAACCGCGAGGACCGACGACGCGCCATGGCGGCGGCCAAGCGCGAGCGCGAACGGG
AGAGTCAGATGAATGAGAAAATGGGCCATCCAGGCGATGTGGACTTCCAGCGCATGATTAAGGCGTTCCGAGAGCAAAATAGGGATAAGAATCGACCTCA
CGCTGAGGCAGGAGACACCAAGATCACCATATGTGTGCGTAAGCGGCCGGTGAATGCCAAGGAGGTGAAGAAACACGACTATGACGCTGTGACGTGTCTA
AATCCCATGGCTATTGTACACGACTGCAAGCTCAAGGTGGACGGGATCACGAAATATCTGGACAGTAATGCCTTCAACTTTGATCATGTGAGTGTGGGCT
CATTGAGATGGAAAGAAGATACTAATGTGGCTTTGTTCCTAGACTTTTGATGAAAACGCGACTAATGAAAGTGTGTACATGCACACGGCTCAACCATTGG
TGAAGTTTGTGTTCCATGATGGAGGCCATGCTACGGTCTTTGCTTATGGACAGACGGGAAGTGGCAAGACGCACACGATGCAAGGTATCCAGAGTCAAAT
TGCGGCGGATGTGTTCGCACAGGCTGATGAGTTTGCAAGACGTGGGTATCCGATGGATGTCTGTGTGAGCTTTTTTGAGATTTATGGCGGACGTTGTCAG
GATTTGTTGCATCGGCAAGTGTTGACGATTCGGGAAGATGGTGCTGGAGAAGTGCAGATTGTGGATTTGGAAGAAGTACAACCGCAGAATACGGACGAGC
TGCTGCAAGTGATCAGCAAAGGCAATAGTCTCCGCACGACACATGCTACAGAGGTGAATGATGTGTCGTCGCGCTCGCATTGCATCTGTCAGATTAACCT
TCGCGATAAAGGAACGGGACGACTTCATGGGAAGTTATCTTTGATCGATCTTGCTGGTAGTGAACGTGGTGAAGACACAAAAAATCACAATCGACAGCGA
CGAATGGAATCAGCGGAAATCAACCGAAGTTTGTTGGCACTGAAAGAGTGTTTTCGGTATCTAAACACTACTGCTTCAATTCTAGTGCGGGTTGCTCCTA
ACCATGTGCCTTCCTAATTCAATGCAGAGCACTAGATAGCGGTGGTCGAGGCACTCACATCCCTTTCCGAGCAAGCAAGCTCACACAAGTACTAAAAGAT
TCGTTTGTCAACGCTAAAGCGAGGTACTTGATCACACACTTGGCATAATCGACAACGTTTCTAACATCGTAATTGATCATCATATGGACAGAACGGTGAT
GATTGCAGCAGTATCACCCTGTGCTTCGTCATCGGACCATACGCTGAATACTCTTCGATATGCTGATCGGGTCAAAGAGAAACGTGTTTCAGCAGATGCA
TTTGATGAGGGGAATGACGAGTCTGACACAGTGGATGTCGAGGATGTTCAATTTGAAGGTGGGTGGGAAATTTGATATTTTGTGGTGATTTCATAAGCTC
TGATTGACGTATACTGTGGAGTTAGACCTTGATGGTGACGATGCGTATCATGCACAAAACGAGGAAGACGAAGCTGAAGATTACGATGACGAAGAAGAGT
ATCCTCCTGGAGAGGAAAATAACGATAATGTTTCCGTGCTTAAAGGCAATGGTGAAAAGTACAGGAGCAAGGCAAGCGATAACAGCAACGATGCAGTGAC
AATCTCATCGCATCACACACACGGGGGGCCTGATTTGGGCGACGACTTAAGCATTCTCCATATTAGTCGTCGGCGTCATTCGAGTACGTTGCGAATATTG
ATGCTGGACGTAATGTGTTTTATGACATATGATCACCATGTGAGCAGATAAAAGGAGTGACCATCCTGTCCAGGAAAGCGGGTACCCTGAGGAAGCATGG
CAAGGAGTGGTAATGATCAGTTTGGTTATTGATGTGCCGAAATTTTGCAACATTAACGACGATGACGTGGTGTATGTATTTTTATTTCCTAATGACAGGT
TCAAACATTGTATGAAGAGCAAGAAGGCTTGCTCAACACGCACATGAGTGCAATTCAGGTTTGTATCCAATTCAAAGACTGCATGTTTTCATATCTAATG
CTTTACTACAACAGGAGAATGCCGAGCTGTTGACAGAGGAAGGCGCCATGTTGGCAGCAATTCAAAATGACGACTCGACAAGTATTGAGCAGTATGTTTC
GCGTCTGGAAGAGGTATGTGCTTGACGATTCACAGTTGCTAGATTTTACCGACAAACAGTCTTACGATTTTTTGCGACTTCTAGATCCTTGCTCAGAAAG
CACAGACAATCAGCACTCTCAGACGGCAGCTTGCTGCTTTCCGGCAACATTGCGAAGGTGAAGAGGAGAAATCAGCCGAGACACCACCCAAGAAAGTTTT
TGTGCGTGGTGGTCGCTAGACCCAACAGTGTGGAACTCGATTCTAGAGCTTTCCACTCTCCAAGTTGAAGTGAAATTGTTACTTAATCCTTACTTCCATA
TCGTCACTTCAATCGCCACTTTAAAAAGTCAAGTCATTTGAGAACTCGAAGTGCCAAGTGAACAGGATGCAGCGAGGACTAGCGACCAAGCTTCTCTCAC
GCGCGGCAGCAGCCTCACAGAGGCAAACTACCCGCCTCCCAGTGGCGACTGAAGCATATGTTTGTCGTATCGCATCGCAATCACAGCCCAGTCAGGCTCT
GCGTTCGTTTACAGTCACTGCGGACTCGAGCGACTCGATACCCTATAGATTCGCTGCTCTTGCAGGGGCTGCAGTACTCGCTGGAAGTATGTGCTTCGAT
GTGAATGCAACGCAGTCAGAAGCGGCTCCGGACAAGAAACAGGAAAAGGTTAGAACGTTTTGGACGATTTTACACATATTTTAGGACATTACCTTAATGC
TCAATGTGTTGTTGGTTGTGGCAGCATTTCGAGTACGCTGAAGCGGTGGATACCATCCGCCAACAAGTGTCGGAGTTCCGTACGACACTTAAAAGCTCCG
AGACTCGTATACCTAAAGCTTTTCCCATCAAGAAGATTGGAATCTCCAGGATCCATGCGCCGAATGGTGTGTCCACGATCCGAATTGAGTTTGCGTGCCC
ATCGTTCGTCGATCAGGAAGCGATCCTTGGTCGCTTCTTGTTGCAGTTGCAGAAGACATCGGTACCTGGTTCCCGTCAGGCTGTCGAGGTGATGCCGGTT
CCATTGGATACTTCCACGAAAAAGTCCGTTGTGGAGTCTTATGAACAACCTGCGGTGACGTACTTGTACGCGAATGGCTCTGGATCGTTCCAGTTTTTAC
GTGATACAACTTCGTTGCAAGCGACGTCAAAGTTCGTTTTCTATAAGGATGAGTTCCTGACGCAAGGCGAGATCGATGCGGTTGTCGGTGCTTATAAGGA
GATTTACTCGTATGCGAATGTCAATGCGTTTTTCCGCCATGACCTTGAGCAACGCCGTAAGAACGCACTCGTTGGACGTGGTAGAAACCCGACTACAGCT
ACTGCGGCAGCACTGGATAGCAAGGTTCGATTGAGGCACTTTCTGTTGAGGGCTTTGGCGTAATACGTATCTCATGTGTACGCTACGGTGGCAGGAAGAG
GCGATCCAACAGCTCCAAGGTCTTGGGATTGACGTTTTTGAGCCAACGCAGAACGAAAACAGTTTGACCTGGGATAGCCTGGTACGTTATAGTAGTGTTT
TGTTGTTGTTTCATTGGTGGACATTATGGCTGACGCTGCTGATGGTTGCATTTTCTAGGCTGGATACGAGAACGTGAAGCTGGAGATTGAAGATACTGTT
GTACTAGCGCTTCAGAATCCAGAGCTGTACGAGCGCATTGCTCAGAAAACCCGTTGCCGCTATGAAAGCAATCGGCCTCGTGCCGTGCTGTTTGAAGGCC
CCCCAGGTACCGGTAAGACTTTAAGTGCACGTATCATTGCGCAGCAGGCTGGGATTCCTATGATTCACATTCCGATCGAGAGTGTGGTATCCAAATGGTA
CGGCGATAGTGAGAAGAAAATGTCGGCAATCTTTGATGCTTGCGAGAAGCTGGATGGTGCAATTATTTTCATCGATGAGGTTTGTTATCGCTAGTGTTTA
CACGGCGAATTACTCGGTGCTGACATCGTATTGCGATAGATTGACGCACTTGCAGGAGATCGTTCTGGCGGTACAATGCACGAAGCTTCGCGTCGAATTT
TATCAGTTTTACTGCAAAAAGTTGAGGGGTTTGCCTCTGCTAAAAAGACCACGGTTGTGTGTGCTACAAATCGGTACGTATGCGAGCTTGTTCAAAGTTA
CAACAAAGATATTAATTGCGTGTGTATGATTGTAGGAAACAAGATCTGGATGCCGCATTGATTAGCCGTTTCGATCTTTCCATCCGCTACAATCTTCCTG
ATGAGAACACTCGCCGCGCAGTGTTTGCCCGGTATGTCTTGCATATAGCAACACAGATGCAAAATTTGTACTGATATTCTGCAACGATATGCCTACCTCT
AGCTACGCTAAACAACTTTCAGACGAAGAACTTTCGCAATTGGCCACCGTGTCACCGCAGCTATCTTGTCGCGATATTAAAGAGGTAGGTTGACCACTTC
ACAGGGATGCTAAAGCGTGGAATGATTTTCTTACTACGTCGTACGTGTTTGTATGCTCCACAGATTTGTGAATATGCTGAGCGCAAGTGGGCGTCAAAGG
TTCTAAAGAAGGAGGAGACGACAGAACTTCCCACTCTCCGAACGTACATGGAGGCTGTGAAGACGCATATAGGCGGGGTATCCAGCCACGGCTCTCAGCC
TGATGTGTATGAGGCATAAATGCTGTAAACCGCTTGAGTGTTGCTCAACCAAATAAATTTCATGCTGTTGTGACCTTGGCGCTAAACTGCTTGTGCCGAG
TTGACGTGCATTTTTAGCAGCTCCTGATACTGCTGGTTGAGCCCATTGCCCAACTTTTCAACAAGTGGTTGACTGTGTCCTACAAAGGAGATGAGTAAAG
AAAATTGAGTGGATATATGCTGATCGCTTACGCATAATTGTTTGAGCAGTTTTCATGAACTGGAGAGCTTCTTCAGTACCATTCCCGCGATGACACAAGA
CACCCTAAAATGTATTTAGGTTAGTTGAGAGTCAACAAGAATTTTGAAATTGAAACGATGACTGAAATTACCATGTTCCACGCTTTCGCGATGAACCACT
CCAAGTCTAGCTCAGAAAACACCAAGTCCAAATTATTAATGAACTGAAGCAGTTGTTCGAGCCACTCGTGTGCTTTTGATTTTGACTCTGCTTGAGTGAT
AAGCCGTCGTAGCAGATAGCACAGCTTGCTCGGGTCGACTGTGTCCTCTTTGATTAGAATTTGAAGCCTGTAAATATTAGATACGTTAATGATGTAAATG
CGTGGGATTACAACGTAGAACTTGTACCCATAGCTGAATATGCTTTGAGCCAAGGACCGATAGTTGTCTCGAACCTGCTCAAATAAGCGATTTGAATGTG
CTGGTTTGACCGTGAATGGATCTTACCTTTGACGCTTCATTGAACTTTGCCGCATACATCACGAGCTCTACATGGCAGCCATGAGTGGAACCACGAAGCA
TGACAGTTTCCTGAATTTGACTTACCTCCAATCTCCATCAGCTCGGGAGCACTGTGTAGTGTGGCCTTGCAAAGATCAAGGATTGCTTCTGTATTTGAGT
CGAAAAGCCTTAACTTCACGGCTACCATTGCCTTCGCCTGTACAAGAAAACAAAGTGGTTAATACCGCTCTTGCTACAGGTATCAGGAGTTTCATACCAA
GTAGCACTTGAATTCGGGGGCCACAGTTGTATCCCCACTATCAATGCATCCGATCCGATTGATCACTTCCAGAAGATTCAAAAGCTGGTCCTTCTCCAAG
GTCTCGATTTTCTTCATGTCAGAACACACAGCAGCCAACAAACATTGCTGAGATCGCTGCACGAGTGGAGATTTTTCCCTGTATAACTCGTCACTTCGTT
CTGCGATGTTTGCTGCCACGATAAAATATCTGGAGTCTTCAGTGCTTTTGGCGATGTCAAAGCTATTTTCCCAATAATGAAACATTGAATATTAGTCTAT
AAAATGTGTAAAGACTGTAATGAGCACTTACCTCATCCGAAAGAACCACTCAAAGACTGAAGTAGGTCCAGATTTCTCTTTGTGATCGATTGTGCCGGAT
CTTGATGATTGCAACAGGAACGCGTTAGCGTAGGTGAGGAATTTCTCGCCGTATGAGCCTTTTGAGCTGTCACTTTGTTGCTGTTGAGTGAATCTGTTGA
ATGCGAGTTGAGCCGCATTTTGTAGAGCGATGGCTGCAGAAACGTTTATCGGAGAACTCTCCGCTTGTGTGAGAGTATTGCATAGCTCATCCAGAATGTG
CATCACAATATCTTGTCTCGTTGGCCCAAGATTGTTTGCTAGCCTTCCCATGGCGAGCATATCTTCAATCTCAAAGTCATCATTGGCTTGTAGCTGCTCC
ATGATGCGCACGAGTTCTTTTTCAGAAGCTCCCGGTTTAGTTTCAATTGCTACTTGGAACAGAACAAACAGAGATTGCTTGGAAGGCTCTGTAGCTACTG
CCTTCTCTGCCCAGTCTACTGCTTCAGAATCGTGGCCCAAGTGGAGGTACGAGCGAGACATGGTCCTGTAGAGCATCAGTCTGATCAATTAACCTTTTCT
GTAGACGTACAGCAAAGAGCATTGCTACCTCATGTACATCGCTTTATCTTGTGTTGTTGAAGCTCCAGCTAATCCAGCATCCGCCCACTTCAA