Description :
From Genome Similarity Track
Location :
Scaffold_2801:720- 2258
Transcript NameFunction/comments
Phyra_87877Hypothetical protein

Sequence
1538 bases(100 bases per row)
GCCTAGGTAAATCTCTAGGGTGTGCTGATTGCAATCCCAGGAAGCGGTGAGGACCTTGTTGTGATACACTGGCGTACGAAGCAGCACCTTGGGCTGGCCG
TCCATATCCCAGCCGTCAGGTGGCAGCTCCACGAGCAGCTTCCCGCCCGCAGGAACCTTGCCATTGACAGTAAACGCCAGCGTCACGTCGGAGACTACCC
CCGGACAGCAATTGGACGGGCTCCAGCGCTTCGCCCCACCAATCGACCCCGGCACGATTTTCGGAATTGCAAAGGCAGCAGGCCCATCAACGATCTGTCC
ACCGCGTGTGGAAGCCGGAACGGTGCTTCTCGCCACGAGTTTCTCGAAGGTCGTGACGACAGCTTCGCTCTGCGGCGTCGCCTTCTCCGGGGTCCCCACG
CCCGACACCACCAGAACCAAGGGCGTGTCCGCGGGGATCACGCTCTCGTTCAGCAGCGTAAACTCCATCGTTCTAGTCGCAGCACTCCAGTTCATCTTCA
CCAGCGGCAGCGCGGCGGTAGTCGCCTGCTCATTCGGGGACGGCAGTTGCAGCACGACAGTCGGCGGCGACGCAGTGGGTAGCGTCCAGCCGTGGTCCGG
CAATTGGCAGGTGATTCGTGCGTGCTTCGCCAGCGGTCCGGTGGTCGTAAAGCGCAGCGCGAACTTGCCGACCACGCCGGGCGTGGCGAACTCGGGCTCC
AGCGCGGAGTGGCCCTTGAAGCTCCCGGCGACGATCTTGCGGTGGCGCTGTGCGAGTTGAAGGTGCGCGCCCCGCTCTTGCTCCGCGCCGCCATCGTCTC
GCACCGAACTGCTCCGTCGCTTCATGCTCCTCGGGAGTCCTACGCAGCGATGGAAAATCCAGTTGGAAAGCGCTCTGCGCTGCCGAAACCGACGGGTTTA
TCATTAGGACGCAGACGTTTCGACCGCGGCGCTCGGTGTGCATGAAGACATTCTCAACCAGCGACACGACAGCGGTAGGATAGCATTGCTGCTGCCAGTG
CAGGACCTGGTATCCATCGGATCGGATGGCGTTCCTGCAACACAATTACAACAAAACGACAGGCCTTGCTGCAACACAACAGGGTTCGGCACCACTAGGA
GCACCGCACGACAGCAACACACGAGAAGGAGATGAGCACGACGCGTAATCTATTCCCGATAAGTTACAGCTATCGTAAAAGTTACGGAGGTGGTTTGCAG
ATATTCCCAGTAGACAGCAGATCCGACGAGATATCCGAAAGAGTTCACAGCGAAGGACGACGACACATGAACCAAGGCAACAGCGCCTCCAACGCCGCAA
ATACCGAGCATTTGACTCCTTTAGCGGCCCCTCCCCCTCCTGGCAATCACCGCCACTACTCTCGTGCTCACAATACGCGTCTGTGCAAGGAGCTACTGCG
ATCTAGATTGCAGTATATTGAGCGGATGGAAGAGAAATCGCAGATAATGACCAAGTATTTGCAGATGGCGCTGGACGCACATGAAGAACTTGTAGCGATG
TTTGCCGAGGAAAAAGAAGACACAATGCGTCTGGCAGT