Description :
From Genome Similarity Track
Location :
scaffold_271:720- 2237
Transcript NameFunction/comments
g6604.t1 hypothetical protein PHYSODRAFT_329629

Sequence
1517 bases(100 bases per row)
TTGTTCTTCAGGTACAGCTTCAGCTGGCCGTAGTCCCACCAGTACACATCGCTGCCGACGTCGACACAGCCAAACAGTCCGAGCTCCTTCGTCCGAGTCT
CTTCGAAGTTGGTCATCATCTTCTGCATTCGCTGGTAGTGTGCGGTAGACTCGGCCTTGTCGACACCCTTCTGTGCCATCACCTCCGTGTAAGCGTCGAG
CTCAAGCGTCAGCGGCATCCAAAAGTGCGGGTCGCTGTCGAGCTTGCCACTCTTGGCCGCGAGTTCCTTTGCGAACTCGCTCAGAAGTGCACGCAACATA
TCGGCGTCGACGCTGAACGATCCAAGACTTGTACCGACCGACTTCATCTCCCCGAAAGAGGACAAAAGACGGATAGCAGTCTCGTGGGTGACCTTGTCCA
CCTGAGCGGCATTGTCCTGCTGGTTCACGACAATGAGACCGTACTTCTCCAGGCCCTTCTCCTTCCACTCCTTCTCCGAAGGCATAGGAGCAAGAGCAGC
CAGGATGTCAATGTGGTGCTTGGCTTCGTACTTGACTTCAGCCGACGGGATGAAAACCTGATCGCCCCAGAAAACGGACAGTCGTCCGCGACGGCTGGAA
GCGTACACGCCGGTCTGCTTCACCACGGCCTCGAGGATCGTCATGGGCACGTACTTGTCCTCGACCTCCACCATGGCCGGCAACTTGACGCCGGACTTGT
TGTTGTTTTCACTACCAGGAAGCGGTGCAAGACGCGTGCCCTTGCCTGCAGTGTGGTACAGCGCGACACTGATGCTTCCCGAAGCGAGCAGCGCCGGGAT
GTCAATGCCGTAGAGCTCCTTGCCAGCCGCCACAGCCTTCGTGTAAGCGTAGAGCGTTCCCAGTCCGTTGCCGGCACCACCGTCCCAGTCCTCGAACACG
GCGATAACCTTGGCGTCCTTGGGCGAGATGGAGCCGCGCGTGGCCATCAGGCGGTCCTGCCAGTACTGGGCCTGGTGTGGCGTGGAGGTGCACACAATGA
CGACGTCGTAGCCGTCGAGACGGTTGATCTCGTCGATGTTGCGCTGGTGCGCCGTGCGCGGAGCCATCGTGGCGGATGTAGAGGAGGAAGTCGGGAGCGA
CTTGGTGGGCTGCAGGCGGAAGCGCAAGTGAGCAGCATAGGCGGCGGCCGCAGCGGCAGAGGCAGCCAGGGAGACCGCCAGGGGCGTGAAGAACTTGACC
ATTGTTGCGATGTGTAGTGGAGTTTTACGTCGTTATGTGCGAAGGGGGAGAGGTTGGTTGATTGGCGTTTGTCCGTTGCGGTACGGGTGTCTCCTCTCTA
TGAATAGGCTTCGGCGATTTAACCGATGACAAGCGAAATGGGAAGTGAGCAATGAACCCGCAACCGCCGCGGCAATTGGGGTGACACGTATGAAGCAACA
ATGCCACGAAAAATAGCCGGTCCAAAAAGGTCTTTGGAAACGCATGGGATCGCGAAGATTCAGAGCCATATATCCGCTGTTGGAACGAACCTGCTCACAG
TCTATCCCCGCTCAATA