Description :
From Genome Similarity Track
Location :
Scaffold_3684:72- 3000
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3684-snap-gene-0.1Phosphatidylinositol kinase (PIK-L4)
Pytar_ATCC12531maker-par_contig_3684-snap-gene-0.2Conserved gene of unknown function

Sequence
2928 bases(100 bases per row)
CTTGCCGTCTCAAGTCTCGCACAATTGGCTGTCTTACGCAAAGGTTGCGCGAAAAGAAGGCTATATTCGAACCGCCACTAGCGCCGTGATGCATGCCGAG
GCGTTGGACAACAAATACGCGACTCTGGAAAAGGCCAAGCTCATGGTTGCTCAAGATAGAATGTACGAGGCGCTGCAAATCCTCGAACCGGTTGATATTG
ACGCGTCCAAGATCGAGTTCAAGGTGGAAGACCCACATTACTTCGCCAAAATTCTCCTCTTGGCGACCAACTGGATGCAAGAATCAGGTCAGCGGCAAGG
ACGGAAAGTAGTCGAGCGGTACGAGGCCGTCATCAAGTTCGATCCAACGTGGGAGAAAGGGTACTTTTACCTCGCCAAGTACTATGAGTACTTGCTGAGT
GTGAGCCACCCCGAAGCGCCAACGGCGATGACATCTGCGAGCAACTCTCGCCACGACGATGCGGCTGTCAACATCGACTCTACCTTCCACTCGCATCTTG
TCAATCTCATGAAGAACTACGTGCTTGCGTTGAGCCATGGTACCAAACACGTGTTCCAGTCGATGCCACGGCTTTTGACGCTGTGGTTCGAGTACGGCGA
GCTATTGCAGCCTGGATCGAACAAGGGGACCAGTGTGAACAAAGCTATGCGAAGCATTGAGATGGAGTTGAGTCAGACCAGTGCCGAGCAGCAAATTCTG
ACGGACATCGCCAAAATCATGCAGGACGCGGCCGAGATGCTGCCTGCGTACGAGTGGCTGGTCTGTTTCCCGCAAGTAACTTCGCGGATCTGCCACCCCA
ATCAAGTGGTCGTCGATGGTGTCAAGAAAATCATGCTCAAGGTGCTCGTCACGTATCCGACTCAGGCGATGTGGCCACTGCTGGGACTTTCCCGCTCGCT
CAACTCGCAGCGGAGAAACCGTGCGCGTGATATCATTGGTGCGACACAGCGCCACTTTTTGTCGGCCGGGCTGCCAGAGGTTGCCAACAGCTATGCGGAA
GGCCAACGACTCGCTGAAGAGTTGATTAGCCTCGCCGGACATGACCCCGGTAACCAGCGGAAAATTCACATCAAGTTGAGTCGCATCCGCACGCTCATTC
TGGTTCCCGTTCAAGCAGGCCTGAATACGGTCTTGCCACTTTCGGGCCTGGCTCCACTTGACGATCGCCACGTGGCGTTCATGCCGCACTCGCNNNNNNN
NNNTCTGAATACGGTCTTGCCGCTTTCGGGTCTGGCTCCACGTGACGATTGCCATGTGGCGTTCATGCCGCACTCGCAGGTGCACATCAAAACGTTCAGC
GATAAAGCCGATGTGATGATGACCAAGGAAAAACCCAAGCGGATCGAAGTTCTCGGCACCGATGGCAAGATCTATCCGTTTCTCTNNNNNNNNNNGAAAC
CCAAGCGGATCGAAGTGCTCGGTACCGACGGCAAGATCTATCCGTTTCTCTGCAAACGCGAAAAGACTGGCGACTTGCGGAAGGACGCGCGGATGATGGA
GTTCAACACTATGATCAACAAACTTCTCCAGAAGGATCGTGAAGGCCGCAAGCGGAAATTGCGGCTTCGCACTTATGCAGTCGTGTGCCTGAACGAAGAG
AGCGGGCTCATGGAGTGGGTGCGTCACACCAAGGCCATGCGCCAGCTGATTGGTCAAATCCACAAAACCGAGCGCGGCTTCATCCAGCCCGTGCGGCTTA
CGCATGAAATCAAGGAGCAGTTCCTGGGTATGCAAAAGAAATTCGCAGGCAACCCCACCATGATGGCTTTGTTTTTCCGCCACAAGATCTTGGAGTTGCC
GGTCTTCACGCCTCGCTTCCATCAATGGTTCACAAACAACTTCGCCGACCCGACTGCATGGTTTGAAGCCCGTCTCGCGTTCTCGCGATCTGCCGCAGTG
TGGTCCATGGTCGGCCACATTATCGGCCTTGGTGACCGCCACGGAGAGAACATTCTGATCGACTGCACCAACGGCGAATGCGTCCACGTCGACTTTGACT
GCCTATTTGACAAAGGCTTGAAGTTAGCCAAGCCTGAGATTGTGCCGTTCCGTCTCACACCCAACATCATCGATGCCTTTGGCATTACTGGGTATGAAGG
CGTCTTTCGCCGCGTGTGCGAGGTCACGATGGCGCTGCTGCGGGATAACCGGGAGACACTGCGGAGTGTTTTGGAGTCATTCATCCACGACCCGCTTGTC
GAGTGGGGGCGGCGGGGCAAAAATGCCCAGGGCATGGCAACCTCCGGCAATGGGCGCGGCATTGCCGACATTTCAAGTGATCGTAGCAAGGAAGAGACCC
GGATCATCCTCAAGACTATTGACGACCGTTTGAGTGGCATTTACAATCTCGGGGACGCGATTCGCCCGCTCGTATCGTCGGCGCACCGCAGCTTGCTGCC
AGAGAACGAGACGCTGCCGCTGTCGGTGCAAGGCCAAGTGGACAAGCTGATCCACGAGGCCACAGCCCACGAGAACCTCGCGCAAATGTACATCGGGTGG
ATGCCGTTTCTGTGAGTCCGACCACCAGCAGCAGCAGCAGTCTTTGGCGGGAGAGCAGTGGTTCGTATATATTTTCATTCTACTCGACACTTTCTGCTCC
CTCTTTTTCTCGCTTTCACTGCCCCCTCTTTTACCCTCACTGTCTTACGCTCTTCCGTTTTGTCTTCTTCTCTCTCGAGAACACTCGCTTGGCCAAGGGA
AGGGTGGCGATCGCTAATGCAAATCGCACCGGCTCGATGGCTTCGTTCACGATGATCGCGAACGAGACGTTCTCATACTTGGGGTCCATTTCGGGGTCGA
TGAGTTCGTCTAATCCGAGCGCCATGACCGTGTCGATCACATGCGTGCCATCGAGCAGGCCCGNNNNNNNNNNCTCGTCTAATCCGAGTGCCATGACCGT
GTCGATCACTTGCGTGCCATCGAGCAGG