Description :
From Genome Similarity Track
Location :
Scaffold_2721:72- 2681
Sequence
2609 bases(100 bases per row)
CTTCGAAGCGAGGGCCCGTTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAGGCTCGGTCGGACGGCAAAGGCTGCGGTCAAGACCGTACGCCGG
AGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGC
TCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAGGCTCG
CGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAG
TGCAATCTCAAGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGA
GGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGG
TGTCGCGGGAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGG
CTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATACCGTACCCGCGC
TCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCA
GGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACT
CCATGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTA
AGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCACGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCC
TAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTT
GATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACC
TCCCGGGGCTCAACAATGGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCT
CCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAG
CGAGAGACGTTTGCGAGGACTCCCTTCCTCATCGCCACCGGCTTTGCGAGTGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGA
CTGTGATCACCGTGATCACTAGCGGACGACTGCACGCTGTCTTCTTTGTGCTCACTAGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCAT
GAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACT
GCGGCGCCTGCTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCG
TGAGGCTTAGTGCTCTTGGCCTGCACCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTCGAAG
TGGAGACCTTGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTACCTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGGCCGAGTCGATGGTTTTCGACTT
TGAGAATGAGAGTTTGTGACGAACATCTCTCCATTCTGATTGGTCGGTAACCCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCACTAAGTGTA
CCCTGGTCACATGAAGTGTGACACTTCACACTCCAGGAGTATGACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAACCAACCA
TTGGTTAAATGACATTGCATTTCTATAGGTAACTGATAGTTTGTATTAACCTCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATT
TAGCTCACTTCGCTCTCTTTAATTAAGAAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCCCTAGCGCAAGGTG
CTGTGTGAC