Description :
From Genome Similarity Track
Location :
Scaffold_148:72- 1873
Sequence
1801 bases(100 bases per row)
gcgttagcttcTTAGCCACAAtagacgcccggcgtctctgttgtcttaagtagtCAAGGCCCTGCCTTTACTGTCATATAAGATACCGGGTACCGAACGA
AttgcgaacttcttggttagagctaaactgactgtattgATAACACTTTTAGGTTCTAACTACTGTAGACAGCCTTAATACTGAACCGCCTtataatgac
gctaaactagGTGGTTGGTCttcagctaacctactgatataggttagttttagcatacgtacttaacctGAAAGCGTACTTAGacgagagccgtgtggga
cacaccatcacTATGTAtcctacaccgggaagtcttattctttcatccgccatttcctgacaacggcgaggccacgcggtggccTTGACCCTTAGCAGGA
CCAACTCAAGATTCTCTGCAGCCACGTCAAGTGAAACGGTGTCTCTCGATGATATCGTTGTGATGGCGTCGTAGTATTTCATGCATCGCAGATAAAACCG
ATGAATCCTTCCGCCACTTGGAGCCGATTAGCCTCAGCAATAATTTGTCCTGCGATTCCGGTAGAGTACTTCTTCCACAAATCAATAACCGTAGAAATCG
CTCTGCTGACTTTGATGCTATTAGCCGTCGGTGACGGCGTGATCGTTCGAGGAAAAGCGTCAGCGAGCGGATTTGACGGCAACGAAGTCGATCCAGAAGC
GACATTAGCATCTTCCCGACTGAGAACTAATCATTTCTTAGTCAGGCTCTTAAGTGTGTCAACTCCCAATGACAGTGTATCCAGTTTGCCGTTTAGAACT
TCCAATCCATCCTTAAGCACTCTCGCAATTTGTGACACTACAGCCGCAAGCGATTTATTTGGGGGTTGTGAGAACGTCGGCATCACAGGCGATAAGTTAA
ATTCCTTGTGCTCCGCTGTAGCAGAGAGTGGGTGTTTCCACAGGCGATGGTTAGGATAATCGCGCCTCAAAATCACAGAATTCTGGAGGAAAACCACTCG
CATATGTCGAAGTATTTGGAGAAACGCTCCTCCTGCAATTTCTCGCTGAGAACTTTGGGACAGAGTTTTAGCTGCTGATCTACTTCAGGGTacaccaact
gctgcaattCAGCGCTTGGTGTGGTCGTTCCACAGCGAAGCCAGTCGCCTCCACGCTTTGTCGAGTACCCTGCCAATGCTCTCATTGCTTTCTTGGGAAG
TGACGTAAGGTAGCACCACTCCATGGGTGCAGTATTTCAACACCCCAACCTCCGAATCTGTTCTACACTAGCACCAAACGTTTCTGCCACTTTTGCCCCC
GATCCTCGATTAGCGTGCATCCACGCAGTCGAGTCAATTCCACAAGCCACAAAAGCGCGTTTGACCCGATTCAACTGGGTGTTGTACGATAATTCCTTAG
CCCTGTCAGCCCCATTAATGAGGTGGATATCATACCAGCGTTCTCGATGTGAAACATCAGGAAATGATTCACAATCAATTTGCCAACGCCAAAACAGGTG
AAGTGCTACAGCATTCAGAGGACACACAGTCACCATATTGCAGTGCATGGCCGCCCCATACTCAATTCGATCGTGCTGGTTCGTTTTACCATTACGGATG
CTATCACCCGTGCTATTGACGGGGTGAACAGTAGAAACCCAGAGAAGTATACTTACTTGAATAACCGCTTAGAGTTTGAGAAGGAGGAACAGAGAAGAAG
CACCAGCAtgaagagaagctggagaagcgtcgagaagaagcagacaaACTCGCGAAGAGCGTATGATGGTGGCTGAGCGTGCAAGAGAGACgtttgtgct
g