Description :
From Genome Similarity Track
Location :
Scaffold_2991:72- 1207
Transcript NameFunction/comments
Phyta_totarag14992hypothetical protein

Sequence
1135 bases(100 bases per row)
CCGTTCTACGTGAACGCCATGCGGCATCTACGCCTGCCGAGTATGCTCGAGGCGGTGGCTTCCTCCTTAAATGAGGGAGGATCTACGGCTGCGACCAGCA
ACCGCAGAAAACAACTGATACATCCACATAATCAGTTGCAACGATGAACAAGAACACTGTGTCTGTGCCGGGCTCATACACCGCTAAGGAAAATGCACAG
ACCGGGCCTGCTGTGAACGACAAACACGCACAAGCCGGGCTTGTAACGAAGTGCATACACGCACAGGCTGGGCCCGTAGAGGAAGACACAGCCGAGCTGA
ACAAGTCATTCAGCTCGGAAGCAATGGACTTTGTCCGGCGTAGTCAAGCCGTCATTAGGTTTGTCCAAGATGCAATAACAGCTTCTGCCGATCGGCAGTG
GCAATACGAATGAATTCGAGATAGGTTCATTAGTTCTGTTAGCTACATAAAACCTAGCTAAAGATGCAGTCTATGAATTCGGAGCAAGCTTGCTTGCTCC
GCACTTTATCGGGCCGTTCACGGTGCTCAAGCGACACGGCAATGCTTACATGTTGGACATACCGTCCAGTACGCACCTCCGTCCGACATGTTACGTCGGG
CGTCTGAAGCCACACGTGCGGCACGAGTCACCTAGTGTTGGTGACCCGCCGAAGACGGGGAGGAAGCAGGGGCTACCtgcttcgtcaacttcgCGAACTT
CGTCCCAAGCTCAACGCCCAATTTCGAGGTGGTCTACGATACCGCCGCGAGCTGAGCCTTCTGAAGCATCCCCACGGCCGACAACTGGTCGAGTAGACGG
CTCGAACCTGACTCATCCAGAGGTTGACCATATGAGGGGCGTGTTCCCGCCTCCCCTGCCACCACTGTGTGACGCACGTGGCTCGACCCGCTGGATAGGG
GAGCGGATTGTTGGTCATACCAACCCGAAGACGAGTCAGGCTCGGCTTCGTATTCGTTGGAGAGAATTCCTCCCCATCAAGATACATGGGAACCGTGGAA
CGTCCTGATGGAGGGCGTTCCGGAAATGGCCAAGGCGTACAAAGCCCAACATGGACTGCAGGCGTAAAGTCTGCACGAGCGTTTTCGTTGCCAACATATG
TTCGGAGCGTCACGTGCTTGCAGACTAGAACCGAG