Description :
From Genome Similarity Track
Location :
Scaffold_80:71983- 73265
Transcript NameFunction/comments
Phymu_g3704hypothetical protein

Sequence
1282 bases(100 bases per row)
GTTCGAAAATTGATTCGTCCTAAATCAACCACGAGGCGAGCACAGTTGTAGTCTGTATCGCTATCCGGAATAATGATGACTGGCGCTTGAATACGGAGAT
CCACGGCAAGTGCGATTCTATTCTCCATCACGTAATCGAGTTTAGCATCAGTTCGAGCCTTCAAATTGACGATATCATTAAATGACgcgacttccagttc
ttccCACAAACCCAAACTCGTAGGAGTGTCCATAAACTTCGCCAACCGCCCCCAGCACCGTGCTGTTGGCGAAAACACGATTTCAAGTGGCTCCATATGA
ACAAACAAAGAGGCATCTGCGCCAGAATTCGCGGGGTTCATCTCAATGCTCATCAGGAACATAACGCCAGACAATTTGCTTACGTTGATATCATCCCCCT
CGCTAGTAGGACGAATAGTTTGCTTTCTACTGAGAAGCCGCGAAAACGCCGAGCTTTCGGCACTTTCATCAAATGCCTCAATAGACTGCAAGGACACATC
CACAACCACTGTTTCATCCctcgccactgcagccatttGTAGTTGAGAAAAAGTACCAAGCAAAAACTCAGTTGGGGCATACTTTCGCCCGTAGCTTGGA
TCATTTCGGAGCAGTGTTCTGTTTGTTTCAGGGTCACTAGCTAGCGTTAGCGACCCACGCTGCAGAGTCACAGTCACTCGATAAAGTTCGCTGAGCTCCA
TCTGAGACTCACTATCAGATACTTCATCTTGCCCACGCACGTCTCGATGTTTATGCGGACGCTTCTTTGAGCGCCGAGGCTCTTCTAGTATGTTGAAcag
ttctcgaagctccacTTCAGGAATAATCCGATGAGGGTTTTTTCCAGATTCTCCGTCTGTAGTAGGTGCAGCCAACTTCGACGTCCAGCCAAACATCCAC
GCGCCCCATGATCGATAGCGAATCTCTGCTGGTACACTAGACTCTGTGAATTCTGTGTCTGCTGATTCTGTATCAGAAAATGCTTGTGATTTGTGTGTCG
GAGGCGTCGGCAATCTGCGTCGAACACGAGTAGCGCGCGAGGCTTGAAACTTTCGAACTTCAAGATCAGCTAAGTAGCGAAAAAGTAAAACGTCTTCGAC
ACTTCGACGTCGTTCAATTTCTTCTAACCCAAAATCAAGCTCAAGAGACGAAAGTTTCGGTAGGTTCGAATAGTCAAGAGGTGAAGGGCACACCCTCCCC
TGGCCACCCAAGGTATCCTTACTGCAATCACCAccatcatcatcgtcatcgtcatcgtcatcgtcatcattgTCTTCACTGT