Description :
From Genome Similarity Track
Location :
Scaffold_1:71972- 73815
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_00035protein kinase, putative
Sappa_CBS223.65SPRG_00036Hypothetical protein
Sappa_CBS223.65SPRG_00037Hypothetical protein

Sequence
1843 bases(100 bases per row)
ACACGATCCAAGTCGATTTTTACGACGCGACGCGGCTCGTTCTCGCGCAGGACGGGCTCGCCATCACGTACATAATCAGCTGCTGTGGCGGCGTCTAACA
TGCGATGCAATAGGTATGTAGACAAGGACGGCACGATGCACGTGCTCTCAACCTACGACGCCGTGCAGCATCCGGCCAAGACGCCGGACCTCGTCAAGCG
CCTCAAGTACGCGCGGCCATTTCGTGGTGTCTCTGATGCCTTCAGTGTAGGTATGTCAAGGACATGCTCGTGCAAATGGTCAAAGCCAAGGCGGCGCCGT
AAGTATGAGCTCTGTAGCCACCCCATATATTATATACAGTGCTATTTTGCGACTTGCGCCGTGTTGTCGTCAATTGATTTGAGAAGCGTTAATGGTTAAG
AGGGACGCATCCAATGGATATGAAGGAATAGCTAGTTTAAGTTTACGAAGGTGGGCTCTCATTAGTAGGAATATTCAGCTAGTGGCTCCACGGAAATCAC
CCCGATCTGCCTGACAGAGAAGTATAACTCAGTGGTATCATACTCTGTGTTTGCATCACGTCTATTTTGTGAAATATAAAATTTCACAGGTAAGACTTTA
CCTACTAATGAGTTAATTACCCCTATGCAGTCGTCCGAACATAGCTACAAATGAGCGCAATGGCAATCCGCTTGAATCTCCACGTGGTCAAAGTGTCCAA
ACTTGGCAGTGGCAAATCACCGACGCGTATTTTGGCGTGTCGCATGGGAACCTGCGAAACATGATATTGCTGTGCACTGGATTCCAGAGGCGACAAATTT
TATCCTGGATTCACGACCGCTCATGTCCGACACTGAGGGCGTCTACGCAGAACGCAAGTGGGATGTATCCAGGCACTATCCAGGCACGTGGATCTATCCA
AGGTGGCTCTGCCAGTGGCTCAAGCGAGCTTCAGAAGCACGGAGTGTGTGGGAACGTCATCGTGCAAGGGAGCTCTTTAGTACCAATAGGTAGTAGTAGG
TATTACTATTCGCAAGATGGAATTGCTTAAATCGATGCCTGGATGTTCGTTGCGCACGTCGATGCTGCAACAAGACATCCCACTCTGCGTCGTGTCCGAC
CATGTCCTGTCCAGCGCCGCTCCGCCCTAGAGACTCGAACCTCTCTGTTTCATTTTCAATTTCGACATCAACCATGCTCCACCTCTTCACGGCAATGAAG
ACGCCGTCATCGACAGACGCGTGGTCGAAGGCCCGCAAGTCCATCGCGCGCGCCAACGCCGGCGCCAAGCGCAACATTTCCCTGGCGCCGCGCCCGCCAA
CGCTCGTGGGCGGCCGCCTCGTGCCGTTTCAGCGCGCCACGCAGAGTCTTCGGGCGCTCGGCCCGATCCTCGAGGAAGACTGTCTCGTCGACGTCTAGAC
AGTAGACAAGACAAGTAGGTTTCATAGTATTTATTCACGAAAAACAACAACGATTGCAGTTGAGCTTGCTTCTGTCGCAACGGTGTCCATAGTGCGAACG
GAGCATCGAATGTACAACATGCCGAGTCGATAGCTTGTGTCAAGGGTCTCTCGCACACACCTGTTTCCAGTTGAACAGAAAATGCCGCCCGACCATCGAG
TACGTCGGACCAAAGGAGACGCGGAGAGGATGAGCGACCACTCAGTATTTCATGCCAATAAGAAAATCGTGTCGAAAAGAGGGGTTCGTGCACACCGTAA
GGAAGCAGGGCGATCCTACATCATCTACATGTACTCTGCTTATGTCTCTGAACGAGCTGCGAAGGGCTACGGAACGCTTGCAAGCCCATAATGATGTCGT
TCAAGGAGGACAAGTCATGCGTAGTAGAGTGCGGGTTGGTCGC