Description :
From Genome Similarity Track
Location :
Scaffold_49:7197- 8474
Transcript NameFunction/comments
Physo_136863hypothetical protein

Sequence
1277 bases(100 bases per row)
GACATGGACCAAGACAGCATGTCGGCGACCGGGATATCAGCCGCTCCCAAGCATTCCTCGATACGCGCAACGAACAGCGTGTCGGGCGCCAGCGTCTTCA
CTTGCGGGAAATACTTGATCAGGTACGCCATCAGCACTCCGATAACCTTGCGACTTACGTTTAGCTTTGCGTCTGCCAGTCCAATGCAGGAACCGAACAG
CAGCTCCTCCAAGCGCGCCAGGTGTTCCTGCGTCCCATGGTCCAGCGCTGCAACGTCCGCAATGACCGGGGCTTCGTCGGCGCTCCAGTCGCTCAGCACT
CGGGCGACTTTTCGGTCTTCGCGGGGGGGGGGGGGTGTTGAAGACATAGGCAAAGCCTTTGTTCGTGCGGGTCATATCCCATGGCCCGCGGTCAAAGATC
CACTGCGCTGCTAGCCGCTCGTCTCCGTTGGCGTGCTGGGCACCTCCTCGGCGAAAGGAGTGCGAGGTCAGGTTGCTGGTGGCACCGGCGGGTTCAGCCA
CCCGCTTCAAAAAGCGGTTGACATACGCTTGGACTCCGTCCTCACCGCGGCCGAGGCTGCTCCTCGCGGGACATGAAGCTGTGAGCTGAGCTGGCAGGGA
GGCGGTGGTGGCTTGCGACGGGTTGGAGCTGGGAGGACTTGGTGTGGGGAGCAGGGAAGCGGTGCTGGGCGGCGACAGGGACGCTTCCAAGGCCGTCGCG
GTGTCGCTGCTATCCGCGACGCTGACCCGCAGCACCTCGAGCAGAGGCGCACCTGCGTCGAGCGAGGTTCCAGCGGTGGTGGCGAGAGCGGGAAGCTGAC
TCAGCAGCGACACACAGGGCGCCTCCTGCATCACCAGAGCAACGGCCAGTGTGTGCAGGGGGCAGGTGAGGAAGTCGTCGCGGTCAGGTACGAGGGTGAG
GTCTTGATCTTCGGCAGTTTTCACGCGAAGCATGCGTACGTAGAAAACGTTGTCTGCTGACACTGTGATGTGCTGCTTGCTGATATAGCCGAGATCCGAG
GAGCGCCCAAAACAGTGCCACATGAGGCACGCGAGCGCCGCATCTTCGTAGTCGGTGGCGACAGACGCCGTGCTGTAGACATAGCGAATTAGTGACCTTA
AATCCGCCTTCGTGCAAGGCGGAGCTTTGTTAGTAAATCCCCCATTGTCCCGTTTCAAGCAATGTTTTTCCAAAGTCTTGCCTTGCTTTAGCAGGGTTAA
CTCTGTAGGAACCCGAAGATGAGGATGCTCATCGAAAAACCAAAGCTTAACGTTTCTAAAGTATGAAATGGCTGTGT