Description :
From Genome Similarity Track
Location :
Scaffold_53:7196- 9053
Sequence
1857 bases(100 bases per row)
GGTAGCGCAACCACAGCTAGAAGACGTCGAGTGAATGAGTCCCTATGTACTTGAGGAAGAAATTCCTCAAGCAGATATTGGTGAGGTAACGAGACCTCAT
CATCCCGAGGGAACAAGTCCCCATCAGCCTGTGGAAAAGGGTTTTAAGAAAGGAACCGAGACATTGAATGTCTTGGTTAATGACGGGTCAAGTGTAGGCG
CTTATACACTTGATCTGATCGCGCCTCCGAAGTCGACTTCGGAGATCAGTCAATTTCCAACGCTCGAACCGAAACGGTTCTTGAGAAATCTGCGTAGTGG
CAAGGTCAAGCAGATCTATGTACTCGTCATGGAGGACGAGTACGTGACTGACATTCGGTCGGCAGTAATATTTGCTGAGAACGAACGGGTCTCAGCATCT
CATCGATGAACGAAAGTGTCCTCGATGAAAAGACTCGGATTGAGAGATACACGTCTCAATCTTGGGAGTCACTTCAGTAAAATTCTTTATATTTGCTGAG
AACGAACGGGTCTCAGCATCTCATCGATGAACGAAAGTGTCCTCGATGAGAAGACTCGGATTGAGAGATACACGTCTCAATCTTGGGAGTCACTTCAGTC
AAATTCTTTATATAAGTAATTGATCGAATTCAAGGACGTGTTCCCTGTATCCGTACCATGCGAATTGCCTAAGGATAAAGGCACTCGACATGAAATCGAG
CTCAAACCGGGCTCGAAGTACTGTGCCATGAAGCAGTGGTCGCTGCCTCGTGAACAAGTACTTGCGACCGAAAAGTTCTTTTCCGATCGCTTAGCTGCGG
GTCATGTGAGGGAGTCAACTTCCCCTCACAGCTCTCTGACCTTATGTTTGCGCAAGGCCACAGGCGGATGGCGGATAGTGCACGCATTCAACAAGCTGAA
TGCTGCCGTCCATGGATCTTATGGATGGCTTCTATGAGATTCTAATGCGTGAACGGGACCTCCTGTACACGGCAGTAAGCATCTCGAGCGGTATGCTATG
GGAGTGGCTAGCAATGTCACAAGGGCTTAGCAACGCCCCTGCCACGTTCAATAGATGTGTTACAGATCTGTTGAGACCGGTGCGAGAATTCGCACCGAGT
TACTTCGACGATGTATTCGTCCATAGCCGGGCTATGGGTGGAAAGGAGGATGTTGAGGTTCATAAAACACACGTTCGTCAGGTTCTTACACTTATGCGCA
AGCGTAAGATGTACGCCAACCTCAAGAATTGTATATTTGCTGCTAGCGAAATACCACTTCTTGGGTGCATCGTGGGTAAATACGGCGTACGCCCTGATCC
TGAATAGATCAGGCGATCACTGACTGGCCGGTGCCAGTCGACGTTAAGGGACTAAGAAAGTTCCTTGGTCTAGCGGCGTACGTACACAAGTACTCGCGCA
ACTACGCCGAGATGACGGTTCACCTCTCTCGTCTTTTGAAAAAGAATGAGAATTGGTCATGGGATGCTGATTGTCAGCGTTCCTTTGAACGTATCAAGCA
GAGCTTGATGCAATCGCCCATCTTGGCGATTGCAGACCAAGACAGACCATTCCATGTTGTCAGTGACGCCAGCGACTTCGCAATCGGCTGCGCGTTAAGG
CAGCACGATGCAGACGGCACAGAGCGTGTCGTCTGTTATCACTCGCGTCATCTGCAAGCATCTGAGCGTAATTATCCAGTGCATGACGAGGAACTCTTTG
CCATGAAGTATGCACTAGCGAAGTTTCGCGTCTATCCCCTTGGAGATAGGCCGTTTGTAGTCTATACGGACCATGCGTCATTACGCACTGCCTTAAACAG
CCCACACCTCTCGCAAAGGATAGCGAGGTGGCTATCCTTCTTTGCGGAGTACAACTT