Description :
From Genome Similarity Track
Location :
Scaffold_99:71956- 75548
Transcript NameFunction/comments
Physo_141468reverse transcriptase

Sequence
3592 bases(100 bases per row)
GGAGATGGAAATGCTGCCCCCGCCCCGGCCAGAGGCGTGGTATGTGATCTGGACGTAGGTGACGCCAAACCTGTCGCCCAACGTCCGAGGTCCATAGCTC
CACATCTCTGGAAGAAGGTCTACGATCTACTCAAGAAGTTGTTGGAAACCGGTTTGGTTGAGTACTCGCAGTCCGCCTGGGCTTCCCCCATCGTGATCGT
CTTGAAGAAGAACGGCGTGGACATTCGCATGTGTATTGACTACCGCGTGGTGAATGGGTTCATCCAGCTCTCGACATACCCACTCCCGCTGATCGACGAC
CTGTTGGTCGGTTTCGAGGCCGCCATGTGGTTCATGAGCCTCGACATGGCCAGCGGATTCTGGGCGGTGCGCATGACAGAGCGTGCGAAGATGATCTCAG
CTTTCATTTGCCCGCTCGGACATTTCCAGTGGGTGCGGATGCCGTTCGGCCTGAAGAATGCTCCGCTTCTGTACCAGGCCGTGATCGACAATTGCCTGTG
GGGCTTCGTCCGACTCCCACCGGAGGAAGAGAAGCTTGTTGATTCGGATGTGTTGGAATTTCTCGGCCTGGATCCGTCGGAGGAAGATGTGTCTGCCCGT
GAAGAGTCCGGCCAGAAGGTTCCCGCCCTGACTGACGCTATGACAGTGTTCCAGCAGAATATTCTGATACCATCACATGTCGGCTCAGTTCTCGGCCGGA
GTTCTTACATCGACGACATCGCCCATGGGGCGCCTACGTGGGACCAGCTCTGCGTAGACCTGAACGTATTGATGTTTCGACTTCGATACTGGAACATTTC
TGTCAGTCTGCCCAAGAGTGAATTTGACAAGTCGGCCATCCTGTATCTCTCGCACGAGATTAGTGCTGAGGGTATTCGAGCCACGCCCAAGATCGCGAAG
GGTTTCCAGGATCTCCCGTTCCCGAAGACCCTGAAGGGGGTGCAGTCTGTCCTGGGGAGTCTCAACTATTACCATAAGTTCATCGAAGGCTTCCCGGTCG
TGGCTGCCGTTCTATACGAACTCACGGATGAGCAAGTTCGTTCCGGGCGAGATCTCTCGTGAGCCAAGGAGGCGTTCGAGATATTGAAGAAGAAGATTGT
CTCGACCCCACTGCCTCGCCATCCAGACCGCACGAGACCGTTCGTGATCATTCCTCATGCCAACCAATGGGCCGCCTGTGCGGTTCTCGGCCAGGGATAC
GACGGTGTCATTCACCCGGTCAGGTTCACGGGGCGTGTGCTGAACGACTCCGAGCTCCGGTATCACATCGCCGAGAAAGAGGTGGTGGCCGTGATGCGAG
TTCTGGACGTGTTCCAACCTCTCGTCCAAGGATGTCTGGTCAAGGTTTTCACTCGACACTCCGTCCTGAGTTGGCTGCTGAAGTCCAAGACGGCGGATGG
AAGATGTGTCCGCTGGGGCGTCACGCTCTCTCATTGGAACCTAGAAGTGCACAAGATTAAGCGAGATGAGGACGGTCTGCCAGCCATTCTTGGCGCAGGT
ATCACACCTCGCGAACATCTGGACGAGGTCGCGGAAAATCTCGTCCCGGCCAAAGGAATTGTCAAGACTCCGCCCGTGATCAGCATCGAAATGCTGGGCG
AGGATTTTGACGGGTACGTCCTAAGTTTCGATGGAGCTGCTAAGACGTCGACCCGTCAAGGCAGCTGCGGATGTATCATCTGGAGGCTCCCCGGCTGGAA
GATCCTGAGCGCACATGGTTTCATTCTGGAAGATGTCACGGTCAATGACGCTGAGTACCATGGCCTGCTCAAGGGCATGGAGCTGGTGTCCGCCCAGAAC
ATCCAAGATTTGGTCGTCGTCGGAGACTCTCGAATTATCATCCAGCAGGTGCAAGGACTCATAAACTGCAACCAACCAAATTTGCAGCGACGTCTGTCCG
AGTACCAAGGTCTGAGAGAGAAGTTCAAGTCGGTCAAGCTGGTGCACGTCAAGCGCGAGTACAACCAATCAGCTGACTACTTAACGTCCAAGACACTGCC
GACCGGAGAGTCCTGGATGGTCGAATACCCGGAGGAATTTAAGCATCTCGAACAAGTCTCGCGAATCCGGGAGAAGTTGATGAAGTCGGAAACTCTGGGC
GAAGTGAGTGGAGAAGTCCCCGCCCAGGATGCCACGACACCGGAAACTCCAGCCGAGTCCCTTCCAGGACCCGAGTCCGCACCGTTGCCGATTGCTGCGC
GCGTCATGGCCGCCGTGACCAGAAGTCAGGCCGGAGAAGAGTCTGACCAGGCTGAGTCTATGGGCCCAGTTGAGTTCCAAGCGGAACGCTGGAGGCGGAT
CAAGGTTCACCAAGACAATGACGCCCAGATTGCGGAGATGAAGAAGTTCCTGGCCGGAGACGTGAGCAGTTACTCCCAACATCAGATTCGGAAGTTGTCG
AAGCCTGCTGAGCTGTTCGCCGTGGACGTCAGGGGCGTGCCGTATCGGTTGAGTCGTGCTACGCGAGACCGACCACGAGACATGTCCGATGAACCAAGGT
TGGTCGTGCCCGAGTCACTCCGCCCGGACATTCTCCACTATGCTCATGAGGACTTCCAGGGCGGACATCAGGGTATAACCTGGACGCACGAAAAACTCTG
GACAGAGTTCTATTGGCCTGATATGTACGCCGACGTGGAGAGATTCGTCAAAGAGTGCGTGGACTGTGCGAGTGGCAAGGGGCGTCCGCCCAACCCGGGG
CCTTCGCCCGGGAATATTGAGCCGAGACAACCATTCGAGGTGGTTTCGATGGACTTCGTCACTCACTTGCCCAAGTCCAAGCGAGGAAATACTTTCTTGC
TCCTCTTCCAGGATGCGTTCTCCGGGTACGTCATGTGCAAGCCCATGGATTCGACCACCGGCCAGGAGGTCGCCGAGGCATACGAGGAGAGAGTGTTCCG
GCAGTTCGGTGCGAGCTCGCTATTACGTCACGACCAGTATCCCCGTTTTATGAGCGAAGTATTTACTCGGTTCCGGGAGCTCCTTGGGAGTAGACAGCGT
GCCACCCTGGCCTACCGACCTCAGGCGAATGGTCAACGAGAAAGGTCCGTCCAGACTGTCGTCCGGAGTATCCGGGCGTACATCGCGGAGTCTGACCAAA
GTGACTGGGACGATCACGCCGAGAGGCTGATGTTCGCCCTGTACACTTCGTTCGATGCGACTCGCCTGGACACCCCGTTCTACCTGGTCCACGGTTGGGA
CACCAGGAGCACTCTGTCGGCCATGCTTGGCCCAAAACCATCCAGTGTCCCTGAGCGGACTGCCTACGAATGGCGTCGGACACTCCAGCGAGGCTACAGT
TACGCCCAAGCATGCGGCGAAGATCTCGAGCGGAAGGCCAAGCGTGCGCGCTCGGCCAAGCAAACGCGGAAGTGGAAGGAATTGTCTGACCGAGTGAAAT
CTGGTTTCGAGGTCGGAGATGCATTTTGGCTGTATATTCCGAAAGTGCAACCCGGCCTGAGTCACAAGTTGGCGCACCTCTGGCATGGCCCGTTCAGAAT
CGCCGAGATGCATGATGACTTCCGGGTGAAGCTCAAGGTCGACGACACTGGTTACCGAGTCAACCCTTGGGTACATGTTTCTCGGCTGAAGC