Description :
From Genome Similarity Track
Location :
Scaffold_83:71917- 78401
Sequence
6484 bases(100 bases per row)
CGTTGCACGCGAGCAGATCCATCGAAACTCAGGACGTACAGATCCTCATCCACTTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCT
TAGGAGCGATCCTAGTCAGTGTTTCGTCCATCTTGGCTCTGGGTGTGATGCTCGCGGTCAAAACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCAC
GATCTCCAGTGTCCAAGGTGAGAGTAAAGCTGCCCATTGTCTCAACCGTCCTTGTAGACCGGCCGACTTGAGCAACCAAGCGAGCGTAGAGTGACGAGTC
AAGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGATATCCAACACCCGCAGGAGTGCGAGTATCTCCTTCTCCACCGCTCCGTAATTCAACTCAT
TCGGTTTTAGCGTTCGGCTGACGAAGGCGACCGGATGGCAGATCCCCTCATGTTCTTGTACCAAAGACGCTGAGACAGCCAAATCACTAGCATAGACTAT
CACCGTAGGTTGACGTTCCGGATCGAAATGGCGGAGGATGGGCGTCGTCGCGATCCCGTTCCTTAGCTCCACAAACGCGTGCTGAGCTCGGATCCACCGA
GGCTCCACCATTTCCGAGCTATCCTTCGTCAGCTCTGTCCGGATTGAATCCTCTTTTAGGTCGGCTTCCGGCGTCGTACTACTTGGACCCCTCGTGGATT
CGGGATCTCTAGGGCCAGAGCTTTTTGAATTTTGGTCCGGACAGCCGAAGATGCCATCGCAGCAGAATCCACCTCCCTCAATTCATAGCGTACTGCAGCA
AACAGTGCGTAATCCTCGATGAACCGAATGTAGTAGTTTAAACTGCCCAAGAAGGATTGCATCGCCCGTAGCGACTGTGGGAAGAACAAGTCTGCCAACG
AAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAGACTCGATGACTTAAGTAATCCACCTTGCGCATCCCCCAATTACTCTTCACCACGCTGAT
AGAGAGATTCTACTTAGTACACGCCTCCAGTAGGAATGTCACTCTGTCGCACTACTGATCCCACGATTCCGCCCGGGATTATAATGTCGTCGATATAGGA
TCTGCGCCCTAACACGGATGGCGCTCCCAGATCACCTGGCTCTCCTGCTTCGAATGGATCCACTTCCGTATGACTTTCCCCGGCTCCACCTCTTTCGGGT
TCCGGTATTCGGGTGAATCCGTATAGGGCATTCTTCAATCCAAACGGCATCCGACTCCATTCGAACAGTCCAAACGGCATCCGACTTCATTCGAACAGTC
CAAACGGTGTGTTAGATGCGGATATTGTGCGAGCTCGATCCGTCATGGTCCCACCTCTTTCGGGCTCCGATATTTGGGTGAATCCGTAATGGGCATTATC
GATCAGGCGTTGTTAGATCTGGGGTGCTATCTTCAATCCAAACGGCATCCGGCTCCATTCGAACAGTCCAAATGGTGTGATGAATGCGGATATTGCGCGA
GCTCGATCCGTCATAGTCACCACCCAAAAACCACTTGCCAATCTAGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAATAGCTCATTGATTAGAGG
CATCGGATACACCATCAGTCGGGTCAGGCCGTTAACTAGCCGGTAATCAATACACAGACGTACGTCCACTCCGGCTTTCTTAACGATGATTACCACCGGA
GATGCCCACGGGGACGTTGAGAAACTGATGATTTTGGCTTGCAGCAGACCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTCCACA
CCCTTTGAGCGATCGGCTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAATGCATTCCCTTTGCCAATTAGCAGATGTCG
GCTTTCCCAGATCTCCTGACGTAGTCGATCCACTTCCGCGGGTTCGTTCGCCCCAGATCCACTTGGATGTCGTCAATCGTGACCTCCTCTGTGGTCAGTC
GTACCTCCGGGATCACCGCCATACCTTCTCCGAGATCCTCGGCGTGTCGATCCCCGCCTTCATGGTAACAGACTTGTTCATCTTCAGACTTCGTCGGATC
CACCATTGAATCCAAGCACCGCGATTCTCCTTCACCCGTCATTCCTTCTGTCTCCGTGGGATCGGGTAGCTTGGTACCGGGGAAGCTACCTGTTGGATCG
ACTTGATCCTCTGGTGAGTTTACACACGACAGTTCCTGTTTGGCTAGTGTTGCCACTTTTGGCAAGGATCCAGGCACTTTGTCCCATGAAAAACTCGGAT
CCACTTGTGGGTAAGCAGGATCCGGCGACCCGGCTTCAGTTCTCTGAGATCCCCCACCCACCGACTCTGGGTTATCTACGGACCGGCTCTGGGGGTCATC
CCCGGTCTTGGAGCCAACCTCTATCACTTGGATCCCAATCCGACGATCCCTCTGTAGGATCTTTCGCGGAGCTGGGTATGAAGGCCGATCTACCAAGGCG
CCAGTTGGCACCGCCGGGGGCTCCCCCTCTCCGAGAGATTCAATCTCGGTAGTCGCCTCATGCGCCAGATTCTGTCATTCTCTATAGCGACGAGATCCCA
CTGATACATATCCAGACCGCCTAGGGATACCATTCTTCGCCAGCCATCGCCCAATTTCTTCATAATGGTCCAGTAATAGTCGCTTATTGCTGACGTTCGT
GACCTGGAGGTATTGTGATCGACCTTGTCCTTGGATTACGGTAGGCACCCATTTCTCACCCCGAGTGACCCACCATTTCTCATGTTCCACCCCCTTAAAC
CGATCTGGCAGTGCCCAAGTCTCTCCGGGCTCGATCCAGGTCGTCTTATCTGCCCTTATGATCCTCATCTTCGCCCCATACAACGGTCGACGCCCTCTGA
GCTGGATCCGCATCTCATCTGGGAAGCACAGTGTCCCATCTGCCAAATCCAACCTTACATCGACTGGTACCATGAAATTCATCCCGAGGATGGCATCTTG
ACCAGCGAGGTCTCCGACTCAAATATCGAGCCAATATACCAAACAACCTGCCAGCGTGATCTTGATCCCCGTTCTCCCATTCGTACGGTACACGCCTTCT
CCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACGCCGGCACCACTATCTA
GGAGAAGGGTTACTTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCCTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCC
CTGTTAGCAGATCCATCGATCCAACATCCTCAGATCCACGTGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTT
AAACCATCGACCATGTTGGCGTTCTTCAGTAACTGCGCGCTTCTCCCCTTTGTAGATTCAGGGCTGAAGAGACTTCGGATCTGGCGAATTTATCCACTTG
GCGCAAACTAGAGACCCTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGGCCTGCTACCTGGATCTAGCGATGTCTTGTTC
ACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCTTCAT
CCCTCTGTGCTTGGCTGGATCAAACCACTGGCGGATCTGGTTGTAGAATTCCTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACAACCGCGACAC
ACGTAGAAGCAATGAGCTCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCTGGATCCGCACTGCGAACACCTG
ATTGGCGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCGCCAGTGCGGGAGTTGTCTCCAGTCTTCGCTGTAC
GATCGTTGGGTACAGTGAGACAGACTCGGCGGTAATCCTCTGGGTCGGAGTCCGAACCATCGGATCCCGATTCACTTCCTGAGTCGGGCGCCGTGACTTG
GTGGACGCGTCGAGCTGGACCCCTGGGTATCGGATCTTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACA
GCCCGCAGCACTTCTTCAAGCTCATCTGCATCTGGAAGACGTAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAATGGTCCA
CGTGCTCCCGTAGTAACTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGCCCGGCCACATATAGTCGATGCAGATATTCCAGCGGGGATGCATC
CGATCTGCGGCGAGAGTGGTAGTATTGTCGTGACACCGACACCCCCAATCCACAGTACTGGGTTTGGAAACTGCGCAGTAAATCGGGCTACCTCTTCCTG
GTGGATCTGCCCAGTTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCTGCAAAGATCCGACACTTTTCAGCATCCGACGCTTGATCTCTCATGA
GGGCTGACTTGACTTTGCTGATTTATTTTTGCGCTCGGCTTCGTCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTC
TGGATCATAGATGATCCATCCGCCCCGGCTGCGGCTGTTGCTACCACCGCTATTGAAGGGGATGGGCCATCCAGATCATCTGAGTCGAACTCATCATGGG
AGTTGTCTCCCTCCACTGACTCCACCTCCACGTCTCGTGCTCCATAGTCATGGAAAACTTGCGTTTGGGGCCTGGGTACCCTCATACCTTATTCGGTTAG
GAAATGACTCATCGCAGCTTCGAAATGTAGTTGCAAAGTGCCTAAGGAGATGTCGGAGGACACTGTAGCCCTAGTCGGGTCTACTGGCAAGGCAGGATTC
GTGGGACGATTAGCTTGAACCCGATCCGACGATAATCCCACTGGCTTCTTGCTGGATCTGGCTCGATCCTGGTTGGATTGTATCAGATCATGGGTAGGGC
GTACTGGATCCCGAGTCTTCACACTCGAGGGCGCTTCCTGTCCCCGGATCCTCGCCCACGCTTCCAGCATGGATGCCCCGGAGGGACCCAAAGTCATGCG
TCGTGGCTCGGACGACGTGTCTGACCCATCCTCAGCGGTGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTG
TGCGGCCCTTCTCCGGTGATGGACTTGACTCTGATGAAAAGGTTCCGCGTCGCCGATACTATTAGATCTAAGTCTAGCTCGAAGCCATCCTCTGTATCGA
ACACACCAGCTACGATGCTTGACTCCGTAAGCAAACGTAATAGATCTTTAACTGCCACCAACTTGTTCGCCATTTTCGTTGGTGCTCTCACCGGTTCCCT
TGGATCTTTGATCTGTCGTGGATTCAGGATCCGCATGACAGGATCTTGATGCATAACGTCGCGTAGAGCTTGGTGGCGATATACAAACTCGAGATCCTTG
TCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTT
CTTCGACTAGCGGGCTTGGGTTTAGGTACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGG
ATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCAGATCCACCTCTCTTCCGTCGACA
GAGTTTCCTCCCAGGACTCCATTGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGATCTCCGACGACGCCTCTTCCCCTGCCTCAATC
TTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCGGC
GACATTGCCGGATCCAACTTACCAACTGCACCCAGACACCGACTAGCGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTA
CCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTAAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGGGAGCAGC
AGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGAATCCTAAGCGAATATTCGAGCTTGCGGATCCAGGGCCTAGATTGTGGATCTGGCCGTAGGG
TTGCCTTGCGGGTGTGTTCCTTGCCTTTGCATTTCCTTTACGTCGTACTTGCCGCCTCCTGTGACGAGATCTTGAGAGTTGAGA