Description :
From Genome Similarity Track
Location :
Scaffold_3:71916- 73309
Transcript NameFunction/comments
Physo_329061Hypothetical protein
Physo_490259predicted protein

Sequence
1393 bases(100 bases per row)
TTTGCCGATGATGCCACTTTTCCCGGACCGGAGCCGAGTGCAGTGCAGACACTGTCTGAGACGGCTGCACTACATCTATTAGCACGACGAATGCCGCTGC
CATCGCTGCTGCTTTTTGGTTTCCCCTGTAGGCGGCGCATGGAATCTTTTTCCTCCATGTCAGAGAAGCAATGCCGCGATTTTAACGCGCTGAGGCGTTT
TCTGAAGTTTGCTGACTGTCACTTGCGTTTAACAAATCCCGAGGAACCGGGCGCCGTCGTGAACGCCCGCCGAGCGACGAGCTCCTGTAGGCGATGGCGG
CGGCGGTACGGAGGCGCGCGACGTGTGAGCGCAGCCGTCTTGCTTGCCGGTGAGCTGGAGTGGAGCTCGGGGACTTGGCCCGTGCTCGTCGGCGGCATGC
TTACTTGGCCGTGGTTTGGGCGCCGCTAATTTGCTGGTTTGGGTTCCGCGCTTCAGTTTTCCGTGTTGCATGGCCGGGGCTCTGTGTTGAACTTGATGAT
TGAAGTTGGCGGGCATAGTGAAAGCAAGAGTCGGCCTCCAATACGTGATATTCTCGGGGAATGCGCGCTCGCAGGTCAACTGAAGTTTTTGTTTTGGGTC
GTCCGTTTTGTTGTTTTGGGTTAGAATATTGTTTTGCTTGACTTGCAGTACCGCTTGGGCCTGTCCATGTGCTGTTACCCTTAACTTCAACATGCCTTGC
TTCAGTTTGCTCGGGAGAAGTACGCAAAATGAATGTTTCATTGACTGCAACACCTATTACTAAACTTACATACTGCTCGCCTGCCTCATAACAAGGTGTT
CCTGTTCTTTGCGAGCTTTGCTGCGCTGGATTGGCCTTCATTCGGTCCGCTGTTAAATATCATCGAGCTGCCTCACCGGCAGCCGGGCTGACCTTGGTCA
GATTAGTCGTCCCTGCGGAGGCCGGCGGACCACTCGCTGTTCTGCTGCAGCGACGTCCAGAAGACCCGCTCGAGGTGGCTAAGTTGGTACAACGCCTGAC
GCTTGGCTTCGGGATCGCACTTGCCCGCGGCGATGCGGTACCAGTGATACTTCCGCACGTAACCCACGAACTTCTTGCTGATGCGCATCGGGTGGCACAC
GAGCACCTCGGACAAGAACTTGCGCAGGGAGACGTTGCCGTGCAGTGGCAGGTAGCCCGACTTGAACGCCTCGATCATGGCCTTGGCATAGTTTTCTTCC
TCCACCGACCACCGGCCGCTGCGCACCCTTCCGTGCTGCGAGTAGTCGGACCGCTTGAGTACACGCTGCGTTGACTTCTTGCCACTTTTGTTGCTTGGGC
TCTGGCGGATCAGGTTCGCGTTGGCGATGGTCTCCGCAACGTTAAGCACATCGGACGACAACGTCGAGGCGCTAGACTCGTTGTTCATGATAG