Description :
From Genome Similarity Track
Location :
contig_5:71912- 87528
Transcript NameFunction/comments
g1499.t1hypothetical protein
g1500.t1hypothetical protein
g1501.t1hypothetical protein
g1502.t1hypothetical protein
g1503.t1hypothetical protein

Sequence
15616 bases(100 bases per row)
CCAGCTAGCCGCCACTACGAAGTGAATACGTCACGCACGGAACGTTTACCAGCGACGACCGCCGCCACCACCGTATCCACCACGGCCACGGCCTCCACCA
CCACCGCCGCGACCCACAAGGTCACGCAGTTCACGCGGCACCTCCTGTTCAGCCTCCTCCATGATCTTCACCAAAGGTCCAGCCAGTCGACCATTGTTAC
CGGGCGTGAAGAACGAGATCGACGTACCCTTGTTACCGGCACGAGCCGTACGACCGATACGGTGAATATAGTCCTCAATGTTCTTGGGCATATCGAAGTT
GACCACGAAGCGGATGTCCTTGATATCCAGACCACGAGACGCCACATCGGTAGCGACCAGGATCTGAGTCTTGCCGTCCTTGAACTCACGCAGCACGTAG
TCACGCTCCTCCTGCGATTTGTTACCGTGAATGGCCTTGCACATGTAGCGAGTGTCACGCAAGTTGCGGCTCAGCTCATCGGCTCCACGCTTCGTCTCAC
AGAAAATAATGATACGTCCTCCCTCGTAAATGTCGCGCAGGTGGTCCTGTAGCGCAGTGTACTTCTGGTGGTCGTCCATAACCTCAACGATCTGCTTGAT
TTTCTTGTTAGCGGTCAGTTCAAGAGAGCCCACCGTCACTTGAATGAAGTCCGTCAGGAAGTCGTTCGCAAGCGACACAATCTCCTTAGGCCACGTAGCC
GACCACATCAACGTCTGACGGTCGGGGCGGATCTGGCTCACGATCTTGCGCAGCTGCGGCTCAAATCCCATATCGAGCATGCGATCAGCCTCGTCAAGAA
CCAAGTAGGTTACACGGCGCAAGTTCGTCTTGCCCATGCTCAGCATATCAATCATACGACCAGGCGTGCAAATGCAGATCTCCACGCCGCGACGCAGGTC
CGCGATTTGGCCACCCTTGGGGACACCACCGTACACACACGTATTCTTGATCTTGGAGCTAGCGCCAAACTTGTTACATTCCGCCTGAATTTGCACAGCG
AGCTCGCGGGTCGGAGCGATGATCAGAACAATCGGACCGTCGCCAGGTTGCAGGTACGGCTACAGCATAAAATAAAAGCACAAAAAGTTAGGAACCACTT
AGATGCAATCGAGCATATGAAGTTGCACGAGAAAGCAAACACAAGCGAGCGCCGAGGGATTGAGGTGTTCGCGTGCTGCTCTTTCTTCTGGCCACCGCCG
ACAACGCACCAATGCATGTTTCGCACCGATTGATCGCCGAGAAGACGCCGGTGGTCGTCGAGAAAGCAGCCAAGATTTGCTATCTGTATGCGTGTCGATC
GTGCCGAGCCAAACAGCCGAAGCCGTCGTAGAAACTCTCTCCGTCAAATGTTCGACCGGCACTCCAACACAGCAAATCACGCTTCGAATCAACTGAAGTG
ACGAAAAACACGCGAATGCCGCTTACTCTAGGATCGCACAATAGCTCTCCACTAAACGAGCATCCGTGTGGATCGACCACGCTCTGAAGACCGTATCCAA
ACCCCAACGCCTCACGCGTGTGACTCGCTCATCGCATCATATGCGCGAACGATCGTCGTGTGCTTGACACAACGTTGCTAACTCCTCCATCAGCGCACAA
GCGCCACGGAAGATGCGTCCAACAACGACCAAAAGCCTCTACAAAGAGTCTGCTTCAAACTACGAACCTGTGCGTTAATGTGCACGATCGCGGGCAGCAA
GAAAGCCAGCGTTTTGCCGGATCCTGTCGCCGAAATGCCCACCATATCGCGTCCTGAAAGCGCCATCGGCCAGCCCTGGCACTGAATGGCCGTGGGCTTG
TCAAAGCCCAGACGCACCACCTCCTCCAGCACGTACTCGGGGAACGAAGCCTCTTCGAACGACAGTACGCACTTGGGCACGCCCTTGCCAGACACGATAA
TCTGGTTCTCACGCTTCCACTGATCGTACTGATCCTCCGAGCGCTTGGTTACGTCCGGATGCTCGTAGTAAAAGTTTTTCTCGAACACCGGCAGCTTCGA
CATGTCCCACTGGATGTGCGTGTCCAGATTGGAGCCGAGGTCACCGCCGCCTCCACCGAAACCGCCACCTCCCCCACGGCCGCCGCCGCCACCGTATCCA
CCGCCGCCACCGCCTCCGTAGCCACCGCCACCTCCATAGCCTCCGCCGCCACCTCCACCACGAGAGTAGCCGCCGCCGCCACCACCGCCGCCGTAGCCAC
CACTGCTGCCTCCGCCGTAGTCACGACGCGAGGAAGAGTCGCCGTATCGGTCACCGCCGCCGCCGTACATGATCAAGAGTGATGGTTTGCCGCTTTCACT
TGCGCGCCACGGGTCGTTTCGACGAATGGGCTGAGTGCGCACTGGGGCGACAGGGGGCAGAGAGCGATCGCTTTGGGCAGGGGAACGGTAACAGGCGGCT
TTTGGTTGGCTGACGGGCGGGCGGCTTTTCCTGCAATCAGGTGTCGCAGCTCGCGCCATTCGTGGAAAATTCGCATAACCGGCCGTGATTGGACGAAACA
AAACGTTTTTTTTTAAAACGATCTTGATGGCTCAAGATTCTTGAGCCATCAAAAGACAAGACCGCACGAAGATGATGGAGAGCGCATGAGCCCGTTGTAT
TGTGCGTTGCAGTAAGCGCAGAAGACGGTGGGGCGGGGTCCTTGCCTCGGTCCGAAGGGTTTACTGGGATGATTTCGCACCCAAAAGTGCGTTCTAAGCC
GCCTACGCTAAGATGGTGCGCTCGTACGAGGCGAACTGCTGGTTGGCCTCCGAGATGCTCACCTCGAGCTTCCGAACTCCACGCTCCTGCAGATTCGGTA
GTTCAATACATTAAAGGGTCAGTAGGCAAGCTGGAGTAGGCAACAGATAGTGGCATAAACATACCAGGAGCGCAACCAGCGTGAATGCGTCCACGAGCTG
GTTGCTCTGTTCCAGGCAGCAGAGAGATAATTGTGAGATATAGACTTCCGCGTAGGATTTCAAACAGCAACCGCACGTACGATGTAAATGGCAAGCTCCT
CCGCCGAAGAGTGCACAATCGGCAGCAACGAACAATCAGCTTTCGGGAAGCTGGACACATGCACAACACTGTTTGTTAGATCCGCTGCCTCTACGCCAGA
CGCCAAATAATCGGCCACCAACCTAAACTTAGCATTATCTTCCGTCAGAATGTGTACGTTCGTGCCATCAAACGAAATCTGCGTGACACCACACTCAAGT
CAGCAATCGGCGCACATCCATTATCCCAACAAAATCACTCCCTCACGTTCAACGCGTCACTGTTCATGGGCACGAGGAACGATTCGTTCAGGTCCTTGCA
GATCACCCGCGAGATCTTCTTGATCTCACCAAAATCCAGGACGTAGCCGTCGCGGCCAACCTGTCCGGTAATCGTGACAGCCAAACGGTAGTTGTGTCCA
TGGAGTTTCTCACGGAATCCCTAAAATACGCACGCAGTAACCAAACATCAGATACTCAACCCTGCTTGGAACTGTACCAATCATGCTGCAGCCGTACCTT
GTAAGCGATGAAGTGCGCCGCATTGAACTTCATGTAGTCCTTCGACACGTGTACCTTGAACACTTCGTTGTAGCCGTTGCCCATCGGGTTGGGTGTAGAC
AAATGAGTCGGCATCGCAGCTACCACAGTCGCACCCGTCTTCTGCAACGTTCGGGCGGGCATCGAGGCGTCACTGCTCAACGCAGGAGGCGAGGTCGCAC
TGCTTCGGAGCGGCTGGATCTGCGCCTTGATTTCCTCTGGAGTCTTGACGCAGCTACGAAGATGGGACGCCCAGCGGTCAACGTTGCGGGATGAGATTTC
CTTGTCGCAGTAGCAGCACTTGACGATGCCCTCAGAAGTGCCACGCGCCACGTACATTTTGGCGATAGCCTTCTGCTCCGCGTTGAGTTCCTTGCCCATG
TCTGTCGAGTTGTGCTTGCGTCTCTTGGTGGTTCCGGTCCCGGGTAGCTCCTCGATCGACGGGGTAGCGAGGCTCTGCTCTGCGATCCGCTTGAGCTCCT
CGTCGTCAACTGACATCCTCAGGCGGGGAAGCACTGGACGCTCGGTTTGAAAATCAACGAGGCTTTTGATTGGTGGATAAATGTCATATGGTGTCTGTCA
CACTATTTCAATGTGAAAGTTTCAACAGTGGCGGAATTTTGATGGCCATGGTAAAAGAAAATGACAAAGTTGAGGCGAATATATATATAGCGTGCCAGCA
ACTCGCCAGTGCGGTCGTGCAGGCTTTGCGGCATGCTGGCGAAGGCGCTCTATTGGTCCGAGACCGCACGCGGCACAACGCTCAAGAAGAAGTTCATGCT
CACGCCTAGCAGCAATCCGACCTTCTGCTTGCGAGGGACGGAGCGGTCAAGAAGCTGGTACAGGGCACACACAGCTCATGTTAGTCACCGCGTAAATCAA
AGAACGGCAGCGAACGGAACTCACCATCAGCAGCATAAATACACCAAGCAGGAGGCCCATCAAGAACCCCCACAGAAATTCAGTGCCGGTGCCTTCATTA
TCTGCTGCCAAAATGGAGTTGTTCATGCCGTTCATGTCGATCTGCGTATCCATCGCAATGCGAGCCGTCGGTACACAACAAGAAAGTAAGTCGATCTAGC
CAAAATAAACCGTTGCAAAGTTCAAGAGAAGCTCATACCGAACTCCGACTGAGGTCCTTGTGACGCCATCCACTCCTCTTCCAGACGATATATCCGGTCC
TCGCTACTCTCGCCAGGGACGCGGTCCGCCTGGCTGATATACACCGAGAGCTGAGGGTAGAAATACAGACGCAACGCCTGGATTTCCTCCCGACTGAGCC
GGTCACGGAGTCTGTCAAAGCCTCTCCGACCGGACGGGTCGTCTCTCTCCTCTGGTTCGCTATCAGTGGCTGCTACCTGCAACATGGTTACGCAATGTCT
CGTTAGCAGTGTGTCCACCAAAATGGACAACCGTCTCTCCACATCCTCGCACCTGGTTCACCACAGCTTTTGGGGGCGCCGAGCTGATGGCGCAGTGTAC
AAAGTCTTCGTTCTTGACCTTGCAGCTCTCGAGTGACGCCTTGTCGTCCGACAGCATCCGACAGCATCTTGCCCTGGTGGATCAGCCGCAGAAATTTGCC
CTCAGCATTGGCTTTCTTCTTCACGAGCTCCTTCAGGTCGCCGACGCTTGCGGAGGGCGCGATCTCCACGCGCAGCGGCTTCTCGCTCAGCGTCTTGACC
TTCAGCACGATGGTCCCGTTGTTGTCTTCATGGATCATGATGCCCACGGCGTCATCGGACAACTAGAATAAAATAAAGAAGATAAGTTCAAATAAAATCG
GAAGCAGCATGGCACAGCCTCTCAGCTACGAGTGTGTACCAGCGGCTTCTCCTCCGTGATGTTCTCGGTGAACTCCGGCTCCATCATGCTGCCTGGATCG
ACCTGTAGGCGCTCACACGCCTCCCTCGACCGCTCAGCGTCCTCCGCACTATTTGATCTGTGCGGTTTTTCTCGCCAGGGCTTTTTTATCAGCTGCGGGT
AGGGATGTGCGAGCCAGTTGGATCTCTCCACTTCTACTGGCCAAAATGGAGCTCTGTGTTTTAGCCAATCCACGACGTTACCGCGAGAATGAACGCCAAT
TCAAAATTTGTCCGTGGCTGAAGCAATGCCCTCCAAGGTGCAAGACGCGGCGGGTTCCGAGAGCTCCCCCAAGCCCCCTGTGACAGCTGAATCTGGAGCC
AAGAGCGAAGCCGTGCAGGTGGCCGTGCGTGTGCGGCCGCTGAGCGCTAATGAGGCGTCACAGGGGTCGGAAACGTGTTTGGACGTGGTTAATGGCAGTA
TCTTACTGGCTGAAAAGCAGTTTGACTTCGATGTTACATTTCCAGCGACGTCAGATCAGGTCCAGATGAAGGCTTTGGTGGCTAGTTTTTTGTGTCCGTT
GTTCTAATGCTTGGTGTTGTATTTGCTGTAGGAGAGCGTGTACACGACATTGGTAGCGCCTATGGTGGACCAGTTCTTCGCTGGCTACAATGCCACAGTG
CTCGCCTACGGGCAGACGGGAACGGGCAAGACGTGAGTGTTGGCGGTAGTCGGATGGTGTGATGTGAGTGTACTGATAGTTTTGTATGTTGAATAGATAC
ACTATGGGCAACGAGTTCGCGTCTAGCGTGGTTCCCGTGGAGCGCGGCGTCATCCTGCGTGTGGTTCAAGATGTGGGTGAAGAAATCATTCACGCAATGA
GTAGGATGGTGTTAATGTCAACAACTCATGCGCTTGCAGGTTTTTGAGCGCGTTGAGGCTTCCGCGAATCCTCAACACTTCGTAATCAGGCTGTCATATT
TAGAGGTGTGTCGCGTGCTCCGTTTTTCTCTGTAATGGATCCATGTTGTTCTAATGATAATCTGGGATGTAGATTTTAAACGAGGAAATCCATGATTTGC
TGAATGTAGCAAAACCTGAACCAAACCCACCTCCGAAGAGTACGGGTCTATCTGTACGCGGTGATAGTGACCGTGGGATTGTTGTTTCGGGGCTCAGTGA
GCATGTCGTGAACACGATGGATCAAGCTGAAGAAATTTTGCGTTCTGGCGCGTTAGTTCGTGCCACAGCTTCTACTACCATGAACGCTAGATCCAGTCGC
TCACATGCAATTTGTACTTTCGTAATGGAGCAGTATGGAGTCAGCGCATCGGGAGGAGGAACGGAAACACGGCTTTCGAAGTTCCATTTGGTTGATTTGG
CTGGCTCTGAGCGGGTCCGTCGCACAAACTCAGAAGGTGCCCGTTTTAGGGAAGGCGTCAACATTAATCGCGGGTTGCTTGCGCTCGGAAACGTTATCAA
CGCGCTATGCGAGCGCAACCGCACAAGTTCGCTAACAGCTCATGTGCCATACCGGGATTCCAAGTTGACTCGACTACTCCAAGACAGTCTGGGTGGTAAC
AGCAAGACACTGATGATTGCTTGTATCAGTCCTGCAGATGTAAACTATGAAGAGACTTTCAACACACTCCGGTATGCGTCGCGAACGCGGGAAATTGAGA
ACAAGGCCGTGATTAACAAGGAGCGGGGACCTGAGAATGAAGTGGTATATCTCAAACAGCAGCTGGAAATTGTGCGGCTGCAGCTGTTACAGCAAACACA
AAGTGCGTCAAGCAGGCCTGGCCGACTTACTCCCCAGGGCTTCAGTGCGGCTAATGGCATTGTGGAGAGCACGTCGGGCGTTAGTGCTCTCGAGGCAGAA
AACCGCAAGCTGAAGGCGGAGTTATCGCTGGCCAACAATGAAAAGAAGAAGTGGAAACAGATTGCGAATGAATTGACGGACAAGAACAAGAACGAGTCAG
AGTTTGCACCAAGCAAGGCTATCGGTAGTCATCTGGATGTGTCGGCACCCATCAAGAAGCATGGTGCGGTTAACGATGGAGAATATGGCAAAAGTGGGCC
TCTGTCACGGCTGGAGCAACTTCGGAAGTTCCAAAGCCATAAAGTGAAGTCACAGCACAGCAAAGATGACACAGCTGTGAAGCGAAAGAATGGGGACTAT
ACCCCGGCAAACATGCACACTCGGACGTTGATGTCACCATCCACCAGCACTCCGGACACTGAAAGCAAAATTTTGAATGCAAGGATGGCTTTAGTACTCC
CTTCCCATATCAAGAGAAGCAGGGTCGGTGAATCTGCTGCTCTTATAATGGGGACAATTACGAAGCTTTTACAGCAGGTGCTAGCGTCCCAAGAATCGAT
TTACAATGCAAAAGTGGATGTCCGAGTGAATCTTGCAAACAGAAATGCTCTGGCGCTGGAGATTTCGCAACTCGAGGGGTCATCCTCAACAGAAAACACT
GAGAGGCTGGCCAGGTTACGAAGTGATCTCCGAAGTAAGTCTGCTAATATTCGGCTTCTCCAACAAAAGTTGGCGAATGTCGGAAAAAACGTGTCGCTGC
CGTCGGGACTTTTTCCCATCAGGTTGGAAACCTGCCATGACTTGATCCGGCATCTCATTGAAACGTTAGTAGGATTCAAAGAGGAGTGTATGGTCCTCCA
GTCGGATGCAGCCAATGAAAGGATTATGAGTCAGCAAGAAGCGCATAGCAAAGTCCAGGCACTGGGTAAGAGATTGAAAGAGGCATTGAAGGAGATGCAA
ACTCTACGGGAGCAATCAACGAAGAAAAAGGCAGCCAAGAAACGAAAAGCTCGAGAGTCGTACGAAACGATGGATACGCTGTTCAGCAGCAGCGGCGAAG
AGGAAGACAATACTGAAGCTGACTCGGACTATGTGGATGAGGAAGTCAATCGGAATGAAGGCAACAAGAGGAAGAGACGTTGCCGTACGCCTGTGTCGGA
AGGGTCCAAGAGAGTAGATGCTATGGACGAAATCGATGAACTGCTAGAGACCAGTGCAGCCACCTGTTGCGCGTGTTACGGCAAATGTGCAACGAAGGCG
TGCGCTTGCAAGTCGCAAAATCGCATCTGCAACAACGAATGCTCGTGCAACTCAAACAAATGCCAGAATCGAGGGGGCGATGACAACACTGGCGAGTCTT
CAGGTGTCGTCCATGACAGCGACGAAGTTCTTGGTATGACCGTCAGTGATGTAGCTCGTTCAACTCCAAAGCGTGGTGCAGGTGATTTTGCCTCGGAAAC
GAGCAGCTCGACGACTTTGATGAACCCCACGGTGACGACATATACAAGCCCCATTATTGACTTAATGTCACCGTGAGCACGCATTTCGGATCCTGCTGTT
CAAAAACATTGGCGAAACGAGAAGCAATACGCTAGAAACGAAGCAACAGACACATCACCATACTAAATGGAACATGTACGTGAGGTCAGGTAAATTCGTG
TATTATTCGTTCGAGGTGAACTCCTTGTGCGTGTCGGCCATTCACCACCGCCGCCTCGCTCAATAAGAGCGACACACAATCTACACCGTTAAGCTTGCTC
TCATGATAGGTCCCCAAAGAGATCCATGTCTAGTGCTTCAGGTTTTCCCGCCATGTATTCGGTATCGTCCTCATCATCGGTGTCAGAGGAGGCATGATGG
CGAGCAGCCACCTTTTCACCTCGACGAGTCGGCGTGCGGATGCTCACGCCGTTCGAGTTCTTACCGTTGCTGCTTCCAATGCTGCCTGTACCCTTGTTCT
CACTCGTCCTTGACCTCGTGCGGATAACAAGTGCAGCCTCCTTGGGCTTCTGATACTGGTATGTGTTGTTGCCGCTTGAAGTCGAAGAGTATTTTGCGCG
CAACGCGCGAGCCTTCTCCTCACTCTTCTTCGCCAAGAAATTCTGAATGAGTTGGCGCTCATGGTTACTCATGTACGACATCTGCACGTCCGCATCGAGC
ACCAGGAAAAGCTCCTGGTATTCGACCTCCTTCTGTGCAAATGATGCAGCGGGCACGAATTCGTAGGAAACCACTTCGAGTATATCGATTGAGTCACGAT
GGTACGGGATACGTGCGAAGCGCAACCGCTCAGCGGGAATTGACAGCGCAGCGCTAGCAGCGTCCGCCAAGCACGTCTCGGGATGGTTTTCCTCGTCTGA
GGTTGAAATCACCACCTCATGCCGCATGTTCTTGACGAAGCGCCACGTCCCGCGGTTCACATACGCAAATTCAACGATTCGGTGGTTGACTTCTGTGGTC
TCTGGCTCTGACAACAGTTCTGCAACAATGCTTCTTCCTTCGTACACCGCAAGTTTTGATGCCTCCACGAGTTTTTGACCATCCACCAGCACGCTTGTCA
TTGTGCTTTGACGTAGATCGCGAAGGCGGACGTGGGATGGAGTCAAATTACCGCCATTTGCATTTATCAAGTCCTTCTGCACTAGTCCATTCCAGACCTT
CTGACGAATATCTTCCACGAGCATCTCCTCACTAATCACGATTTGGTCCACAAATGTCAGCAATGAATCATCCTTTCCTGTCGCCACCAGCACCTCATCA
ATATCAAAGAAATCGTGGCTGTTGCTGTCATCTGCTGATGTCACGGTAGGTTGACCCTGGTTGTTGTCCTCACCCTCGGGTGAAACGGAACTACCGTTGG
ACGGATTGTAGAACATCAATCGAAAGTTGTACTCCCCCGTGTTCAGCGGGGTGCCCTCCAAAGCGAAGACCGTGTGGTTGGAGCCGATTGACAGCTTGGA
TAGAGTACTATCGATAGCCTTGATTTCTACACCAGCACTGTTGATGCCACGTAACAGCTTGAATTTGTTCGAGGGCAGGCCAATCTTAGCACTAATTCGC
TCCTTTAGCGCACGGATCGTCTCCCGCCTGTCAATGCGAATGGGCTCGGCAGGGCTCGTCAAGTACTTAAAGTTTACGGTAATCATGTTGGCCTCACGCT
CAAAGAACGCCTCAGCAGGGGACGCAAGCGTAAGATCTGGTGTCTCCTCGAGGTACAACTCCGTCCCATTCACCAAGTGCAGATCCATCTTTAGTCGCAG
GTTCCGTGTGCGCTCTTCATCGTTTGCATTCAGAATCTTGGCTGCAGAAATGCTGTATGTGGTTGCGCTCTTCTTGATGAGGCGAATCTTCTGTTCAGCT
GGGACGGAGAACTTTTTGGCGATCAGAGCACAGAGAGAGACTATGTTTGCACCCTCGTCCACCTGAATGCACCTTGCCATGAACGAGCTCTGGAAGGTGT
TGCTGGTGCTGCTTGTAGGCTCAGATTCTGGATCAACAAAGCGACGAATAAAGAGCTGGAGCTTTGTTGGATCATGATCTTCCCATTCTTCGTCATCGTT
CTTAACCTCGAGGAACATCTGCTGTCCGGCATAGATACCCAATGATGATAACGTCATGTCCTCTTTATCGTTGTACGTGTCAGATAGCAGGCAGTTATAG
TCGTTGTATCCTCGCAATCTCACGTTTTCTATCGAAGGTACAACCACGTCCTTCTCGATCGCAAACCCCTTGTACGCTGTTTCAACTGCCTCGCGAATAG
TCGAGGTCTTGTAGACGTAGATGGCCTTCTCTATGTTTTTAGGCCTGGAACCCTTCATAAAAAACTTCACTTGCACCTTCTTCGCCATCTCAATCCGCTC
CTGCTCAAGTTTGCGAATCTTGTCTTCATCAGCGTGAATCTTGTCTTTCAAATATTGTGGAATACTATCCGGCAAAATTACATTTACGTTCTTCTCTGCA
GAAACCAAGCGATACAACAGCATGTACGCACACGTGCTGTAGCGCATGCTGTAACCAGAACCACTAGCGCCTCCAAATGCAGTCTTAAGCTCTGTGTCTG
AGATCTCACTCACATTGGAGTCATTGAAGTTGTACCACTTGCCCGTCTCCAGGGATTTAATGTACGCGTAGTAGTGCCCACCCAGCGCGCTGCCAGAGTG
AATGAGCACCGAGTACAGCTCATACACATGCGGCCCTGAGCGCTTAATCATGACCTCAGGGTCAAATATGGAGCTCCACGTGTCAAACGAAGCAGCACCT
TCCACATCGTCTTCTTCCTCCTCCTCCTCTTTTTCGTCATTATTCACAAACGTCATCGGCTGCGATTCATCCATAGAAGACAGGCGGCGCATACGTTCAC
CCATAGCAGCAAGTCCAGGCGTTGGGGGAGGAGAAGAAGGTATCGTAGGCACTACATCCTCAGATGATTTAGGGTGGTTCTTGCCCTCCAACACGTGACG
CTCCATCGACATTTTTCTAGCAATCTTACCCCGTACCCCTCCGTTCTCGTCGCTCACGTACGAGTTCATGTCCAGGTACTTGGGGAACGTCACCTCGTTG
TGTAATTTAATTCGGTTCATCGTAGCATAGTCAAAATCAAAACGTTTCAGCTGCAGCATCAAAATGTACGGCAGCTTGGAGAATTTCAGTCCCTTAATCG
CGTCACGTTTAACCTTGCATCGGTCGCACATCCACTGGTTTTCCTTGTCCAGCACCTCCGGGCGCAAAAACAGCTCAATAGCCTCCTCCACAGTCTTCAT
CATTTCCGTCGATCCAAAAGGTCGGATCACAAGCGACAAATCCAAAAAATTATCAATCCTCGAGCTCTCGTATCCACACTCACAGCATTGCACATAATCC
TTGAGCGATCCCTGGTACAAATCATTCACAAGAGTCTCGTTCACCGTGCCCTTAAAAGACTTCTCCAGTGCGTCCAGCAGCACTCGACAGAGCTCCTGCA
CATCATGTTGCTGGAACACGTCCGCTCCTGTCCAGCCAAAGCTCTTAGTCAGAGCCTTGGTAGAAATAGAGTCCTGTGTCGTGAGTTGCAGCTTGGCGAA
CAGGTTCTGGAGTTGCAACGGGATGTTGTCTTCGTCTGCCTCTTCGTCGCTGTCCTCGTCTTCTTCTTGCTCGGTCAGCTCCGCTTTCTTGGCTGCATGA
CGGCACGTCCAGTTGTACAGGCCCTGACGGAACTCGGGCGTCATGAACATGCTCTGCAGAAGACTGTTCATGTAGCACGTGGCTCCCTGGTTGGACAGGC
CAGTGAAGGCGTTCCTGGCTCTGCTGTAACCCCCAGAGCTACCATAGCTGCTTCCACCATTGCTCGTGTAGCCCGGCGAGTCGTAGAGTCCCTCCAGCCC
CGAAGAACTGTACGTCGTGAGCGCCGTGGACTGCACGCTGGGACTCGCCGCACTGTCCGCGTCGTCGTCGGCGCGCGGCAGCTGCGTCAGCACGGAGGCC
ACCTGCGCACGGTGTTGCTCGCGAGATGTCGAGGCCTCGTCGTCGTCGCTCGAGTCCCAGCTCATGCCAGAAACTCTCGGGGGATCTCCAGGTCGCCAGT
CGCTCATGCTCAAAGGATTTTCGCTATTACGACTGAGATCTGGTGTGAGGGAGGATGTGGTGTATGTAACACAACATATAAGTACCGTGGATAGAGTGAC
AGAAAGTGCCTGTTCGTCGACCACCGGAAGAAGGCTGAGACGTGTGGTGCTTTTGGCACTGGAATTGATGTTTGAGTTGAGTATGCCTGAGCCTGGAGGA
GTTAGCGTGATGATAATGGTCGGTGGTTGGAAAGATAAGAATGTGCTGACGAGACAAAAATGAAAACGAGGAGCGAGGGTGAGCTCAACAGAACACAGCA
GTGACTATGCAAACAGTTTCCAGTCTTAGATATCATCGCTTGTCTGACGTCGACGAGGTCCCAAGACTTACACCATGCGTGGCGTGGGGGATCTGTTCTT
CGCCAACGGCAGCTCCTCATCCGAGTCTTCCGAACCGTAGTAGGCTCTGTCGCGCTTGAGCGTGAACGTGTCGGTGAGGAAGTCCAACTCGCCCGCGCGC
AGCTTCTCTTTCCGCCACATCGTGTAGCACACGCCCATTGCAACGGCGTACAGCATGGCTAAGCAGCAGCGAGAAAAATAATTCATCCAACCACACCGAC
AGTAGCACAAACGCACCCCGACAGTCAATACGTCACACAAATAAGTCTCCACACACGACCAACACCCAATTAAAATTGAAGGCAATTCCTACCGGCCTCA
AAGCACGAGTTGGCCCCCGAGTTGGGTGTCTTGGCGTTGTGAATGTACATCGGCTGCAGCTTCAGCAAAGAACCGACCACTACCTGCAAATTCAGCACAA
TGTGGAGTCACCAGCAGAGTTAGAAACAGCCAGAACATCGCAGCAGAGCGCTCTGCGACCAGCGAAAGCGACATGGCCGTGTACCAGGAAGACGAAGCCC
ATGAAGCTGAAGATGGTGCCGCACAAATAACCTGCAGCGGGCGCAACAGACATCGCCAGATAGAGCAGACGCAGGTTAATCAACCGGGTAGCGAGAACAC
CGCGACTGAGGACACGTACCCCCTCCACTCATGCTGCCGTCTGATACTCCGCTTCTTCCTCTTGCGAATTGTCGATCCAGCTGCCGTCTCCGCCCCTAGG
CATTTCATCCAATGGGAGGATCACAAGATGGATACGCGGCTCTGAACCACTTTAGTGTGTCGAAACACCAAATAACGTGTTGCACACAATATTCTAACTT
GAAGTTTACGTAAAATAAAGCAGGTCATCGCTCAATGCTGCATCATTGCCTGCTTCACTGTCATGGGCGTCGCCAAGAAGCTGCGCGTGCTGTGCATGCA
TGGGTACCGCACCAACGCCAAGATCATGGAGGACCAGGCGCGCGGACTGCGCAAGGCTCTGGCGCCGCACGCCGAGTTCGTGTTTCTGAACGGGCCCATC
GAAGCCCGCGGACCCTCGGACGACGTCATCGAGACGCGATACGCCGAGCACAAGCCATTCTACGAATGGGGGAGCTTCATCGAGCGCAAGCGACCGCAGG
AGTGCGACCCGGAGACGCAGGAGCTCGTGTACACCGACCAGGGCTGGTACCACGACTACGTGGACTGGGACGCCACGGTGCAGTACATGGACGAGCAGCT
ACCGAAGCTCGGGCCCATCGACGCCGTCGTGGGCTTCTCCCAGGGCGCACAGACTATGACGGCGCTGACGATGTGGTACCTGCACAATCACAACAAGCGC
TGGTGGAAATGTTGTGTGAGCGTCTGCGGCCCAAGGGTGCGTGGGGCTGCGCTCCGTCCGCTATTTGAGAATGAGGATGGGAGTCCTCGGTTGGTGCCCA
TGCCCTCGATCCACATCGTCGGGAAGACGGACAAGTGGCATCGAGGCTGCCACGAGATGGTGGACATGTACGAGGACCACCCGGACGGAGCAGCACGCGA
CAAATTCGTGTTCGAACACGACACGGGCCACCGCTTCCCTTCCGGAAAGAGACACGACCAGCTCTACGAGGACGTGGCTCAGATCATCCTGCAGCATTGC
CAGTGAAGCAATAGAGGTGGGTCTGGAGGGTAAAAAGTAAATGCCAATGAACTATAGCTTTGCCCGAGCATTGTTGAAGATGCCGTAGATCGACTCATCA
GCATTGAAGATAGTGGTCCGAACGTCAGGAGACTTCACATCTAGATTTGCGGCCGAAGCAGCTCGAGGACTTCTGAGAGAGCTGCGCACGCTCAAACACA
CGTCCTCGATAATGAGAGTTGCGACGAAGAAGCTTCGCATTCTGTGCCTTCACGGCTACCGGACCAACGTGAAGGTGATGCAGGATCAGACGCGGGCTCT
GCGTCATGTCATGGCCCCCCACGCGGAATTTGTGTTTGCCACAGCCCCATTCAAGGCGCGCGGTGCCTCGGACGAGACGATTGAGCGGCTTTACAAGGAC
CATGCGCCGTTTTACGAGTGGGGCCACATCACCAGGTTGGATCGCCAGTCAGACACGAGCGACAACGGATGGTACCATCAATACGTCGGGTTCGACCGGG
TCGTGGAGCACATCGACAAACAGGTGCAAGACCACGGCCCTTTCGACGCCGCCATCGGCTTTTCGCAGGGTGGCCAAATACTCACTGCGTTGTCGATGTG
GTACCTGCACCAACGCAACGAACGCCACTGGAAGTGCTGTCTCATTTGCTCGGGCACCCGTGTGCGAGACGTAGGTTTGCGTCCTCTCTTTGAACACGCT
GACGGTTCGCCCAAGCACGTCCCAATACCATCCATTCATCTCATCGGCAAGAAGGACCCGTACTACAACACCTGCCACGAGCACGCCGAGCTGTACGCTG
CCAGCCCAAAGTTTGTGTTTGAGCATGAAAGCGGCCACCGATTCCCGTCTGGTGATCGCCATCCCGAACTCTACGAGAAAATCTCGGATATGATCCGAAA
GCACTGCAACAATTGA