Description :
From Genome Similarity Track
Location :
scaffold_5:71910- 87542
Transcript NameFunction/comments
g8106.t1 putative RNA helicase
g8107.t1 predicted protein putative
g8108.t1 conserved hypothetical protein
g8109.t1 hypothetical protein PHYSODRAFT_358780
g8110.t1 hypothetical protein PHYSODRAFT_310097

Sequence
15632 bases(100 bases per row)
CCAGCTAGCCGCCACTACGAAGTGAATACGTCACGCACGGAACGTTTACCAGCGACGACCGCCGCCACCACCGTATCCACCACGGCCACGGCCTCCACCA
CCACCGCCGCGACCCACAAGGTCACGCAGTTCACGCGGCACCTCCTGTTCAGCCTCCTCCATGATCTTCACCAAAGGTCCAGCCAGTCGACCATTGTTAC
CGGGCGTGAAGAACGAGATCGACGTACCCTTGTTACCGGCACGAGCCGTACGACCGATACGGTGAATATAGTCCTCAATGTTCTTGGGCATATCGAAGTT
GACCACGAAGCGGATGTCCTTGATATCCAGACCACGAGACGCCACATCGGTAGCGACCAGGATCTGAGTCTTGCCGTCCTTGAACTCACGCAGCACGTAG
TCACGCTCCTCCTGCGATTTGTTACCGTGAATGGCCTTGCACATGTAGCGAGTGTCACGCAAGTTGCGGCTCAGCTCATCGGCTCCACGCTTCGTCTCAC
AGAAAATAATGATACGTCCTCCCTCGTAAATGTCGCGCAGGTGGTCCTGTAGCGCAGTGTACTTCTGGTGGTCGTCCATAACCTCAACGATCTGCTTGAT
TTTCTTGTTAGCGGTCAGTTCAAGAGAGCCCACCGTCACTTGAATGAAGTCCGTCAGGAAGTCGTTCGCAAGCGACACAATCTCCTTAGGCCACGTAGCC
GACCACATCAACGTCTGACGGTCGGGGCGGATCTGGCTCACGATCTTGCGCAGCTGCGGCTCAAATCCCATATCGAGCATGCGATCAGCCTCGTCAAGAA
CCAAGTAGGTTACACGGCGCAAGTTCGTCTTGCCCATGCTCAGCATATCAATCATACGACCAGGCGTGCAAATGCAGATCTCCACGCCGCGACGCAGGTC
CGCGATTTGGCCACCCTTGGGGACACCACCGTACACACACGTATTCTTGATCTTGGAGCTAGCGCCAAACTTGTTACATTCCGCCTGAATTTGCACAGCG
AGCTCGCGGGTCGGAGCGATGATCAGAACAATCGGACCGTCGCCAGGTTGCAGGTACGGCTACAGCATAAAATAAAAGCACAAAAAGTTAGGAACCACTT
AGATGCAATCGAGCATATGAAGTTGCACGAGAAAGCAAACACAAGCGAGCGCCGAGGGATTGAGGTGTTCGCGTGCTGCTCTTTCTTCTGGCCACCGCCG
ACAACGCACCAATGCATGTTTCGCACCGATTGATCGCCGAGAAGACGCCGGTGGTCGTCGAGAAAGCAGCCAAGATTTGCTATCTGTATGCGTGTCGATC
GTGCCGAGCCAAACAGCCGAAGCCGTCGTAGAAACTCTCTCCGTCAAATGTTCGACCGGCACTCCAACACAGCAAATCACGCTTCGAATCAACTGAAGTG
ACGAAAAACACGCGAATGCCGCTTACTCTAGGATCGCACAATAGCTCTCCACTAAACGAGCATCCGTGTGGATCGACCACGCTCTGAAGACCGTATCCAA
ACCCCAACGCCTCACGCGTGTGACTCGCTCATCGCATCATATGCGCGAACGATCGTCGTGTGCTTGACACAACGTTGCTAACTCCTCCATCAGCGCACCA
GCGCCACGGAAGATGCGTCCAACAACGACCAAAAGCCTCTACAAAGAGTCTGCTTCAAACTACGAACCTGTGCGTTAATGTGCACGATCGCGGGCAGCAA
GAAAGCCAGCGTTTTGCCGGATCCTGTCGCCGAAATGCCCACCATATCGCGTCCTGAAAGCGCCATCGGCCAGCCCTGGCACTGAATGGCCGTGGGCTTG
TCAAAGCCCAGACGCACCACCTCCTCCAGCACGTACTCGGGGAACGAAGCCTCTTCGAACGACAGTACGCACTTGGGCACGCCCTTGCCAGACACGATAA
TCTGGTTCTCACGCTTCCACTGATCGTACTGATCCTCAGAGCGCTTGGTTACGTCCGGATGCTCGTAGTAAAAGTTTTTCTCGAACACCGGCAGCTTCGA
CATGTCCCACTGGATGTGCGTGTCCAGATTGGAGCCGAGGTCACCGCCGCCTCCACCGAAACCGCCACCTCCCCCACGGCCGCCGCCGCCACCGTATCCA
CCGCCGCCACCGCCTCCGTAGCCACCGCCACCTCCATAGCCTCCGCCGCCACCTCCACCACGAGAGTAGCCGCCGCCGCCACCACCGCCGCCGTAGCCAC
CACTGCTGCCTCCGCCGTAGTCACGACGCGAGGAAGAGTCGCCGTATCGGTCACCGCCGCCGCCGTACATGATCAAGAGTGATGGTTTGCCGCTTTCACT
TGCGCGCCACGGGTCGTTTCGACGAATGGGCTGAGTGCGCACTGGGGCGACAGGGGGCAGAGAGCGATCGCTTTGGGCAGGGGAACGGTAACAGGCGGCT
TTTGGTTGGCTGACGGGCGGGCGGCTTTTCCTGCAATCAGGTGTCGCAGCTCGCGCCATTCGTGGAAAATTCGCATAACCGGCCGTGATTGGACGAAACA
AAACGTTTTTTTTTAAAACGATCTTGATGGCTCAAGATTCTTGAGCCATCAAAAGACAAGACCGCACGAAGATGATGGAGAGCGCATGAGCCCGTTGTAT
TGTGCGTTGCAGTAAGCGCAGAAGACGGTGGGGCGGGGTCCTTGCCTCGGTCCGAAGGGTTTACTGGGATGATTTCGCACCCAAAAGTGCGTTCTAAGCC
GCCTACGCTAAGATGGTGCGCTCGTACGAGGCGAACTGCTGGTTGGCCTCCGAGATGCTCACCTCGAGCTTCCGAACTCCACGCTCCTGCAGATTCGGTA
GTTCAATACATTAAAGGGTCAGTAGGCAAGCTGGAGTAGGCAACAGATAGTGGCATAAACATACCAGGAGCGCAACCAGCGTGAATGCGTCCACGAGCTG
GTTGCTCTGTTCCAGGCAGCAGAGAGATAATTGTGAGATATAGACTTCCGCGTAGGATTTCAAACAGCAACCGCACGTACGATGTAAATGGCAAGCTCCT
CCGCCGAAGAGTGCACAATCGGCAGCAACGAACAATCAGCTTTCGGGAAGCTGGACACATGCACAACACTGTTTGTTAGATCCGCTGCCTCTACGCCAGA
CGCCAAATAATCGGCCACCAACCTAAACTTAGCATTATCTTCCGTCAGAATGTGTACGTTCGTGCCATCAAACGAAATCTGCGTGACACCACACTCAAGT
CAGCAATCGGCGCACATCCATTATCCCAACAAAATCACTCCCTCACGTTCAACGCGTCACTGTTCATGGGCACGAGGAACGATTCGTTCAGGTCCTTGCA
GATCACCCGCGAGATCTTCTTGATCTCACCAAAATCCAGGACGTAGCCGTCGCGGCCAACCTGTCCGGTAATCGTGACAGCCAAACGGTAGTTGTGTCCA
TGGAGTTTCTCACGGAATCCCTAAAATACGCACGCAGTAACCAAACATCAGATACTCAACCCTGCTTGGAACTGTACCAATCATGCTGCAGCCGTACCTT
GTAAGCGATGAAGTGCGCCGCATTGAACTTCATGTAGTCCTTCGACACGTGTACCTTGAACACTTCGTTGTAGCCGTTGCCCATCGGGTTGGGTGTAGAC
AAATGAGTCGGCATCGCAGCTACCACAGTCGCACCCGTCTTCTGCAACGTTCGGGCGGGCATCGAGGCGTCACTGCTCAACGCAGGAGGCGAGGTCGCAC
TGCTTCGGAGCGGCTGGATCTGCGCCTTGATTTCCTCTGGAGTCTTGACGCAGCTACGAAGATGGGACGCCCAGCGGTCAACGTTGCGGGATGAGATTTC
CTTGTCGCAGTAGCAGCACTTGACGATGCCCTCAGAAGTGCCACGCGCCACGTACATTTTGGCGATAGCCTTCTGCTCCGCGTTGAGTTCCTTGCCCATG
TCTGTCGAGTTGTGCTTGCGTCTCTTGGTGGTTCCGGTCCCGGGTAGCTCCTCGATCGACGGGGTAGCGAGGCTCTGCTCTGCGATCCGCTTGAGCTCCT
CGTCGTCAACTGACATCCTCAGGCGGGGAAGCACTGGACGCTCGGTTTGAAAATCAACGAGGCTTTTGATTGGTGGATAAATGTCATATGGTGTCTGTCA
CACTATTTCAATGTGAAACTTTCAACAGTGGCGGAATTTTGATGGCCATGGTAAAAGAAAATGACAAAGTTGAGGCGAATATATATATAGCGTGCCAGCA
ACTCGCCAGTGCGGTCGTGCAGGCTTTGCGGCATGCTGGCGAAGGCGCTCTATTGGTCCGAGACCGCACGCGGCACAACGCTCAAGAAGAAGTTCATGCT
CACGCCTAGCAGCAATCCGACCTTCTGCTTGCGAGGGACGGAGCGGTCAAGAAGCTGGTACAGGGCACACACAGCTCATGTTAGTCACCGCGTAAATCAA
AGAACGGCAGCGAACGGAACTCACCATCAGCAGCATAAATACACCAAGCAGGAGGCCCATCAAGAACCCCCACAGAAATTCAGTGCCGGTGCCTTCATTA
TCTGCTGCCAAAATGGAGTTGTTCATGCCGTTCATGTCGATCTGCGTATCCATCGCAATGCGAGCCGTCGGTACAACATTGAGCGCTAAAACACAGCAAC
AAGAAAGTGAACAAGTCGATCTAGCCAAAATAAACCGTTGCAAAGTTCAAGAGAAGCTCATACCGAACTCCGACTGAGGTCCTTGTGACGCCATCCACTC
CTCTTCCAGACGATATATCCGGTCCTCGCTACTCTCGCCAGGGACGCGGTCCGCCTGGCTGATATACACCGAGAGCTGAGGGTAGAAATACAGACGCAAC
GCCTGGATTTCCTCCCGACTGAGCCGGTCACGGAGTCTGTCAAAGCCTCTCCGACCGGACGGGTCGTCTCTCTCCTCTGGTTCGCTATCAGTGGCTGCTA
CCTGCAACATGGTTACGCAATGTCTCGTTAGCAGTGTGTCCACCAAAATGGACAACCGTCTCTCCACATCCTCGCACCTGGTTCACCACAGCTTTTGGGG
GCGCCGAGCTGATGGCGCAGTGTACAAAGTCTTCGTTCTTGACCTTGCAGCTCTCGAGTGACGCCTTGTCGTCCGACAGCATCTTGCCCTGGTGGATCAG
CCGCAGAAATTTGCCCTCAGCATTGGCTTTCTTCTTCACGAGCTCCTTCAGGTCGCCGACGCTTGCGGAGGGCGCGATCTCCACGCGCAGCGGCTTCTCG
CTCAGCGTCTTGACCTTCAGCACGATGGTCCCGTTGTTGTCTTCATGGATCATGATGCCCACGGCGTCATCGGACAACTAGAATAAAATAAAGAAGATAA
GTTCAAATAAAATCGGAAGCAGCATGGCACAGCCTCTCAGCTACGAGTGTGTACCAGCGGCTTCTCCTCCGTGATGTTCTCGGTGAACTCCGGCTCCATC
ATGCTGCCTGGATCGACCTGTAGGCGCTCACACGCCTCCCTCGACCGCTCAGCGTCCTCCGCACTATTTGATCTGTGCGGTTTTTCTCGCCAGGGCTTTT
TTATCAGCTGCGGGTAGGGATGTGCGAGCCAGTTGGATCTCTCCACTTCTACTGGCCAAAATGGACCTCTGTGTTTTAGCCAATCCACGACGTTACCGCG
AGAATGAACGCCAATTCAAAATTTGTCCGTGGCTGAAGCAATGCCCTCCAAGGTGCAAGACGCGGCGGGTTCCGAGAGCTCCCCCAAGCCCCCTGTGACA
GCTGAATCTGGAGCCAAGAGCGAAGCCGTGCAGGTGGCCGTGCGTGTGCGGCCGCTGAGCGCTAATGAGGCGTCACAGGGGTCGGAAACGTGTTTGGACG
TGGTTAATGGCAGTATCTTACTGGCTGAAAAGCAGTTTGACTTCGATGTTACATTTCCAGCGACGTCAGATCAGGTCCAGATGAAGGCTTTGGTGGCTAG
TTTTTTGTGTCCGTTGTTCTAATGCTTGGTGTTGTATTTGCTGTAGGAGAGCGTGTACACGACATTGGTAGCGCCTATGGTGGACCAGTTCTTCGCTGGC
TACAATGCCACAGTGCTCGCCTACGGGCAGACGGGAACGGGCAAGACGTGAGTGTTGGCGGTAGTCGGATGGTGTGATGTGAGTGTACTGATAGTTTTGT
ATGTTGAATAGATACACTATGGGCAACGAGTTCGCGTCTAGCGTGGTTCCCGTGGAGCGCGGCGTCATCCTGCGTGTGGTTCAAGATGTGGGTGAAGAAA
TCATTCACGCAATGAGTAGGATGGTGTTAATGTCAACAACTCATGCGCTTGCAGGTTTTTGAGCGCGTTGAGGCTTCCGCGAATCCTCAACACTTCGTAA
TCAGGCTGTCATATTTAGAGGTGTGTCGCGTGCTCCGTTTTTCTCTGTAATGGATCCATGTTGTTCTAATGATAATCTGGGATGTAGATTTTAAACGAGG
AAATCCATGATTTGCTGAATGTAGCAAAACCTGAACCAAACCCACCTCCGAAGAGTACGGGTCTATCTGTACGCGGTGATAGTGACCGTGGGATTGTTGT
TTCGGGGCTCAGTGAGCATGTCGTGAACACGATGGATCAAGCTGAAGAAATTTTGCGTTCTGGCGCGTTAGTTCGTGCCACAGCTTCTACTACCATGAAC
GCTAGATCCAGTCGCTCACATGCAATTTGTACTTTCGTAATGGAGCAGTATGGAGTCAGCGCATCGGGAGGAGGAACGGAAACACGGCTTTCGAAGTTCC
ATTTGGTTGATTTGGCTGGCTCTGAGCGGGTCCGTCGCACAAACTCAGAAGGTGCCCGTTTTAGGGAAGGCGTCAACATTAATCGCGGGTTGCTTGCGCT
CGGAAACGTTATCAACGCGCTATGCGAGCGCAACCGCACAAGTTCGCTAACAGCTCATGTGCCATACCGGGATTCCAAGTTGACTCGACTACTCCAAGAC
AGTCTGGGTGGTAACAGCAAGACACTGATGATTGCTTGTATCAGTCCTGCAGATGTAAACTATGAAGAGACTTTCAACACACTCCGGTATGCGTCGCGAA
CGCGGGAAATTGAGAACAAGGCCGTGATTAACAAGGAGCGGGGACCTGAGAATGAAGTGGTATATCTCAAACAGCAGCTGGAAATTGTGCGGCTGCAGCT
GTTACAGCAAACACAAAGTGCGTCAAGCAGGCCTGGCCGACTTACTCCCCAGGGCTTCAGTGCGGCTAATGGCATTGTGGAGAGCACGTCGGGCGTTAGT
GCTCTCGAGGCAGAAAACCGCAAGCTGAAGGCGGAGTTATCGCTGGCCAACAATGAAAAGAAGAAGTGGAAACAGATTGCGAATGAATTGACGGACAAGA
ACAAGAACGAGTCAGAGTTTGCACCAAGCAAGGCTATCGGTAGTCATCTGGATGTGTCGGCACCCATCAAGAAGCATGGTGCGGTTAACGATGGAGAATA
TGGCAAAAGTGGGCCTCTGTCACGGCTGGAGCAACTTCGGAAGTTCCAAAGCCATAAAGTGAAGTCACAGCACAGCAAAGATGACACAGCTGTGAAGCGA
AAGAATGGGGACTATACCCCGGCAAACATGCACACTCGGACGTTGATGTCACCATCCACCAGCACTCCGGACACTGAAAGCAAAATTTTGAATGCAAGGA
TGGCTTTAGTACTCCCTTCCCATATCAAGAGAAGCAGGGTCGGTGAATCTGCTGCTCTTATAATGGGGACAATTACGAAGCTTTTACAGCAGGTGCTAGC
GTCCCAAGAATCGATTTACAATGCAAAAGTGGATGTCCGAGTGAATCTTGCAAACAGAAATGCTCTGGCGCTGGAGATTTCGCAACTCGAGGGGTCATCC
TCAACAGAAAACACTGAGAGGCTGGCCAGGTTACGAAGTGATCTCCGAAGTAAGTCTGCTAATATTCGGCTTCTCCAACAAAAGTTGGCGAATGTCGGAA
AAAACGTGTCGCTGCCGTCGGGACTTTTTCCCATCAGGTTGGAAACCTGCCATGACTTGATCCGGCATCTCATTGAAACGTTAGTAGGATTCAAAGAGGA
GTGTATGGTCCTCCAGTCGGATGCAGCCAATGAAAGGATTATGAGTCAGCAAGAAGCGCATAGCAAAGTCCAGGCACTGGGTAAGAGATTGAAAGAGGCA
TTGAAGGAGATGCAAACTCTACGGGAGCAATCAACGAAGAAAAAGGCAGCCAAGAAACGAAAAGCTCGAGAGTCGTACGAAACGATGGATACGCTGTTCA
GCAGCAGCGGCGAAGAGGAAGACAATACTGAAGCTGACTCGGACTATGTGGATGAGGAAGTCAATCGGAATGAAGGCAACAAGAGGAAGAGACGTTGCCG
TACGCCTGTGTCGGAAGGGTCCAAGAGAGTAGATGCTATGGACGAAATCGATGAACTGCTAGAGACCAGTGCAGCCACCTGTTGCGCGTGTTACGGCAAA
TGTGCAACGAAGGCGTGCGCTTGCAAGTCGCAAAATCGCATCTGCAACAACGAATGCTCGTGCAACTCAAACAAATGCCAGAATCGAGGGGGCGATGACA
ACACTGGCGAGTCTTCAGGTGTCGTCCATGACAGCGACGAAGTTCTTGGTATGACCGTCAGTGATGTAGCTCGTTCAACTCCAAAGCGTGGTGCAGGTGA
TTTTGCCTCGGAAACGAGCAGCTCGACGACTTTGATGAACCCCACGGTGACGACATATACAAGCCCCATTATTGACTTAATGTCACCGTGAGCACGCATT
TCGGATCCTGCTGTTCAAAAACATTGGCGAAACGAGAAGCAATACGCTAGAAACGAAGCAACAGACACATCACCATACTAAATGGAACATGTACGTGAGG
TCAGGTAAATTCGTGTATTATTCGTTCGAGGTGAACTCCTTGTGCGTGTCGGCCATTCACCACCGCCGCCTCGCTCAATAAGAGCGACACACAATCTACA
CCGTTAAGCTTGCTCTCATGATAGGTCCCCAAAGAGATCCATGTCTAGTGCTTCAGGTTTTCCCGCCATGTATTCGGTATCGTCCTCATCATCGGTGTCA
GAGGAGGCATGATGGCGAGCAGCCACCTTTTCACCTCGACGAGTCGGCGTGCGGATGCTCACGCCGTTCGAGTTCTTACCGTTGCTGCTTCCAATGCTGC
CTGTACCCTTGTTCTCACTCGTCCTTGACCTCGTGCGGATAACAAGTGCAGCCTCCTTGGGCTTCTGATACTGGTATGTGTTGTTGCCGCTTGAAGTCGA
AGAGTATTTTGCGCGCAACGCGCGAGCCTTCTCCTCACTCTTCTTCGCCAAGAAGTTCTGAATGAGTTGGCGCTCATGGTTACTCATGTACGACATCTGC
ACGTCCGCATCGAGCACCAGGAAAAGCTCCTGGTATTCGACCTCCTTCTGTGCAAATGATGCAGCGGGCACGAATTCGTAGGAAACCACTTCGAGTATAT
CGATTGAGTCACGATGGTACGGGATACGTGCGAAGCGCAACCGCTCAGCGGGAATTGACAGCGCAGCGCTAGCAGCGTCCGCCAAGCACGTCTCGGGATG
GTTTTCCTCGTCTGAGGTTGAAATCACCACCTCATGCCGCATGTTCTTGACGAAGCGCCACGTCCCGCGGTTCACATACGCAAATTCAACGATTCGGTGG
TTGACTTCTGTGGTCTCTGGCTCTGACAACAGTTCTGCAACAATGCTTCTTCCTTCGTACACCGCAAGTTTTGATGCCTCCACGAGTTTTTGACCATCCA
CCAGCACGCTTGTCATTGTGCTTTGACGTAGATCGCGAAGGCGGACGTGGGATGGAGTCAAATTACCGCCATTTGCATTTATCAAGTCCTTCTGCACTAG
TCCATTCCAGACCTTCTGACGAATATCTTCCACGAGCATCTCCTCACTAATCACGATTTGGTCCACAAATGTCAGCAATGAATCATCCTTTCCTGTCGCC
ACCAGCACCTCATCAATATCAAAGAAATCGTGGCTGTTGCTGTCATCTGCTGATGTCACGGTAGGTTGACCCTGGTTGTTGTCCTCACCCTCGGGTGAAA
CGGAACTACCGTTGGACGGATTGTAGAACATCAATCGAAAGTTGTACTCCCCCGTGTTCAGCGGGGTGCCCTCCAAAGCGAAGACCGTGTGGTTGGAGCC
GATTGACAGCTTGGATAGAGTACTATCGATAGCCTTGATTTCTACACCAGCACTGTTGATGCCACGTAACAGCTTGAATTTGTTCGAGGGCAGGCCAATC
TTAGCACTAATTCGCTCCTTTAGCGCACGGATCGTCTCCCGCCTGTCAATGCGAATGGGCTCGGCAGGGCTCGTCAAGTACTTAAAGTTTACGGTAATCA
TGTTGGCCTCACGCTCAAAGAACGCCTCAGCAGGGGACGCAAGCGTAAGATCTGGTGTCTCCTCGAGGTACAACTCCGTCCCATTCACCAAGTGCAGATC
CATCTTTAGTCGCAGGTTCCGTGTGCGCTCTTCATCGTTTGCATTCAGAATCTTGGCTGCAGAAATGCTGTATGTGGTTGCGCTCTTCTTGATGAGGCGA
ATCTTCTGTTCAGCTGGGACGGAGAACTTTTTGGCGATCAGAGCACAGAGAGAGACTATGTTTGCACCCTCGTCCACCTGAATGCACCTTGCCATGAACG
AGCTCTGGAAGGTGTTGCTGGTGCTGCTTGTAGGCTCAGATTCTGGATCAACAAAGCGACGAATAAAGAGCTGGAGCTTTGTTGGATCATGATCTTCCCA
TTCTTCGTCATCGTTCTTAACCTCGAGGAACATCTGCTGTCCGGCATAGATACCCAATGATGATAACGTCATGTCCTCTTTATCGTTGTACGTGTCAGAT
AGCAGGCAGTTATAGTCGTTGTATCCTCGCAATCTCACGTTTTCTATCGAAGGTACAACCACGTCCTTCTCGATCGCAAACTCCTTGTACGCTGTTTCAA
GTGCCTCGCGAATAGTCGAGGTCTTGTAGACGTAGATGGCCTTCTCTATGTTTTTAGGCCTGGAACCCTTCATAAAAAACTTCACTTGCACCTTCTTCGC
CATCTCAATCCGCTCCTGCTCAAGTTTGCGAATCTTGTCTTCATCAGCGTGAATCTTGTCTTTCAAATATTGTGGAATACTATCCGGCAAAATTACATTT
ACGTTCTTCTCTGCAGAAACCAAGCGATACAACAGCATGTACGCACACGTGCTGTAGCGCATGCTGTAACCAGAACCACTAGCGCCTCCAAATGCAGTCT
TAAGCTCTGTGTCTGAGATCTCACTCACATTGGAGTCATTGAAGTTGTACCACTTGCCCGTCTCCAGGGATTTAATGTACGCGTAGTAGTGCCCACCCAG
CGCGCTGCCAGAGTGAATGAGCACCGAGTACAGCTCATACACATGCGGCCCTGAGCGCTTAATCATGACCTCAGGGTCAAATATGGAGCTCCACGTGTCA
AACGAAGCAGCACCTTCCACATCGTCTTCCTCCTCCTCCTCCTCTTTTTCGTCATTATTCACAAACGTCATCGGCTGCGATTCATCCATAGAAGACAGGC
GGCGCATACGTTCACCCATAGCAGCAAGTCCAGGCGTTGGGGGAGGAGAAGAAGGTATCGTAGGCACTACATCCTCAGATGATTTAGGGTGGTTCTTGCC
CTCCAACACGTGACGCTCCATCGACATTTTTCTAGCAATCTTACCCCGTACCCCTCCGTTCTCGTCGCTCACGTACGAGTTCATGTCCAGGTACTTGGGG
AACGTCACCTCGTTGTGTAATTTAATTCGGTTCATCGTAGCATAGTCAAAATCAAAACGTTTCAGCTGCAGCATCAAAATGTACGGCAGCTTGGAGAATT
TCAGTCCCTTAATCGCGTCACGTTTAACCTTGCATCGGTCGCACATCCACTGGTTTTCCTTGTCCAGCACCTCCGGGCGCAAAAACAGCTCAATAGCCTC
CTCCACAGTCTTCATCATTTCCGTCGATCCAAAAGGTCGGATCACAAGCGACAAATCCAAAAAATTATCAATCCTCGAGCTCTCGTATCCACACTCACAG
CATTGCACATAATCCTTGAGCGATCCCTGGTACAAATCATTCACAAGAGTCTCGTTCACCGTGCCCTTAAAAGACTTCTCCAGTGCGTCCAGCAGCACTC
GACAGAGCTCCTGCACATCATGTTGCTGGAACACGTCCGCTCCTGTCCAGCCAAAGCTCTTAGTCAGAGCCTTGGTAGAAATAGAGTCCTGTGTCGTGAG
TTGCAGCTTGGCGAACAGGTTCTGGAGTTGCAACGGGATGTTGTCTTCGTCTGCCTCTTCGTCGCTGTCCTCGTCTTCTTCTTGCTCGGTCAGCTCCGCT
TTCTTGGCTGCATGACGGCACGTCCAGTTGTACAGGCCCTGACGGAACTCGGGCGTCATGAACATGCTCTGCAGAAGACTGTTCATGTAGCACGTGGCTC
CCTGGTTGGACAGGCCAGTGAAGGCGTTCCTGGCTCTGCTGTAACCCCCAGAGCTACCATAGCTGCTTCCACCATTGCTCGTGTAGCCCGGCGAGTCGTA
GAGTCCCTCCAGCCCCGAAGAACTGTACGTCGTGAGCGCCGTGGACTGCACGCTGGGACTCGCCGCACTGTCCGCGTCGTCGTCGGCGCGCGGCAGCTGC
GTCAGCACGGAGGCCACCTGCGCACGGTGTTGCTCGCGAGATGTCGAGGCCTCGTCGTCGTCGCTCGAGTCCCAGCTCATGCCAGAAACTCTCGGGGGAT
CTCCAGGTCGCCAGTCGCTCATGCTCAAAGGATTTTCGCTATTACGACTGAGATCTGGTGTGAGGGAGGATGTGGTGTATGTAACACAACATATAAGTAC
CGTGGATAGAGTGACAGAAAGTGCCCTGTTCGTCGACCACCGGAAGAAGGCTGAGACGTGTGGTGCTTTTGGCACTGGAATTGATGTTTGAGTTGAGTAT
GCCTGAGCCTGGAGGAGTTAGCGTGATGATAATGGTCGGTGGTTGGAAAGATAAGAATGTGCTGACGAGACAAAAATGAAAACGAGGAGCGAGGGTGAGC
TCAACAGAATACAGCAGTGACTATGCAAACAGTTTCCAGTCTTAGATATCATCGCTTGTCTGACGTCGACGAGGTCCCAAGACTTACACCATGCGTGGCG
TGGGGGATCTGTTCTTCGCCAACGGCAGCTCCTCATCCGAGTCTTCCGAACCGTAGTTGGCTCTGTCGCGCTTGAGCGTGAACGTGTCGGTGAGGAAGTC
CAACTCGCCCGCGCGCAGCTTCTCTTTCCGCCACATCGTGTAGCACACGCCCATTGCAACGGCGTACAGCATGGCTAAGCAGCAGCGAGAAAAATAATTC
ATCCAACCACACCGACAGTAGCACAAACGCACCCCGACAGTCAATACGTCACACAAATAAGTCTCCACACACGACCAACACCCAATTAAAATTGAAGGCA
ATTCCTACCGGCCTCAAAGCACGAGTTGGCCCCCGAGTTGGGTGTCTTGGCGTTGTGAATGTACATCGGCTGCAGCTTCAGCAAAGAACCGACCACTACC
TGCAAATTCAGCACAATGTGGAGTCACCAGCAGAGTTAGAAACAGCCAGAACATCGCAGCAGAGCGCTCTGCGACCAGCGAAAGCGACATGGCCGTGTAC
CAGGAAGACGAAGCCCATGAAGCTGAAGATGGTGCCGCACAAATAACCTGCAGCGGGCGCAACAGACATCGCCAGATAGAGCAGACGCAGGTTAATCAAC
CGGGTAGCGAGAACACCGCGACTGAGGACACGTACCCCCTCCACTCATGCTGCCGTCTGATACTCCGCTTCTTCCTCTTGCGAATTGTCGATCCAGCTGC
CGTCTCCGCCCCTAGGCATTTCATCCAATGGGAGGATCACAAGATGGATACGCGGCTCTGAACCACTTTAGTGTGTCGAAACACCAAATAACGTATTGCA
CACAATATTCTAACTTGAAGTTTACGTAAAATAAAGCAGGTCATCGCTCAATGCTGCATCATTGCCTGCTTCACTGTCATGGGCGTCGCCAAGAAGCTGC
GCGTGCTGTGCATGCATGGGTACCGCACCAACGCCAAGATCATGGAGGACCAGGCGCGCGGACTGCGCAAGGCTCTGGCGCCGCACGCCGAGTTCGTGTT
TCTGAACGGGCCCATCGAAGCCCGCGGACCCTCGGACGACGTCATCGAGACGCGATACGCCGAGCACAAGCCATTCTACGAGTGGGGGAGCTTCATCGAG
CGCAAGCGACCGCAGGAGTGCGACCCGGAGACGCAGGAGCTTGTGTACACCGACCAGGGCTGGTACCACGACTACGTGGACTGGGACGCCACGGTGCAGT
ACATGGACGAGCAGCTACCGAAGCTCGGGCCCATCGACGCCGTCGTGGGCTTCTCCCAGGGCGCACAGACTATGACGGCGCTGACGATGTGGTACCTGCA
CAATCACAACAAGCGCTGGTGGAAATGTTGTGTGAGCGTCTGCGGCCCAAGGGTGCGTGGGGCTGCGCTCCGTCCGCTATTTGAGAATGAGGATGGGAGT
CCTCGGTTGGTGCCCATGCCCTCGATCCACATCGTCGGGAAGACGGACAAGTGGCATCGAGGCTGCCACGAGATGGTGGACATGTACGAGGACCACCCGG
ACGGAGCAGCACGCGACAAATTCGTGTTCGAACACGACACGGGCCACCGCTTCCCTTCCGGAAAGAGACACGACCAGCTCTACGAGGACGTGGCTCAGAT
CATCCTGCAGCATTGCCAGTGAAGCAATAGAGGTGGGTCTGGAGGGTAAAAAGTAAATGCCAATGAACTATAGCTTTGCCCGAGCATTGTTGAAGATGCC
GTAGATCGACTCATCAGCATTGAAGATAGTGGTCCGAACGTCAGGAGACTTCACATCTAGATTTGCGGCCGAAGCAGCTCGAGGACTTCTGAGAGAGCTG
CGCACGCTCAAACACACGTCCTCGATAATGAGAGTTGCGACGAAGAAGCTTCGCATTCTGTGCCTTCACGGCTACCGGACCAACGTGAAGGTGATGCAGG
ATCAGACGCGGGCTCTGCGTCATGTCATGGCCCCCCACGCGGAATTTGTGTTTGCCACAGCCCCATTCAAGGCGCGCGGTGCCTCGGACGAGACGATTGA
GCGGCTTTACAAGGACCATGCGCCGTTTTACGAGTGGGGCCACATCACCAGGTTGGATCGCCAGTCAGACACGAGCGACAACGGATGGTACCATCAATAC
GTCGGGTTCGACCGGGTCGTGGAGCACATCGACAAACAGGTGCAAGACCACGGCCCTTTCGACGCCGCCATCGGCTTTTCGCAGGGTGGCCAAATACTCA
CTGCGTTGTCGATGTGGTACCTGCACCAACGCAACGAACGCCACTGGAAGTGCTGTCTCATTTGCTCGGGCACCCGTGTGCGAGACGTAGGTTTGCGTCC
TCTCTTTGAACACGCTGACGGTTCGCCCAAGCACGTCCCAATACCATCCATTCATCTCATCGGCAAGAAGGACCCGTACTACAACACCTGCCACGAGCAC
GCCGAGCTGTACGCTGCCAGCCCAAAGTTTGTGTTTGAGCATGAAAGCGGCCACCGATTCCCGTCTGGTGATCGCCATCCCGAACTCTACGAGAAAATCT
CGGACATGATCCGAAAGCACTGCAACAATTGA