Description :
From Genome Similarity Track
Location :
Scaffold_636:7191- 9855
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_636-snap-gene-0.9Transmembrane protein
Pytir_DAOMBR486maker-pir_contig_636-fgenesh-gene-0.5Conserved gene of unknown function

Sequence
2664 bases(100 bases per row)
GATTTGCCAGGAGGATATTGTCGCGAACTTTTACACGCGGTACGCATTCCAAAGTCACGAGGTCCCTGAAGCCTGGATGGCACCAGTCGAGAGTCGCGCG
GAAGACGAGTTGCTGCGTTTCCTCGACATGATCAGCCTCAGCGTCCCGTACCACAAGATCGTGTGCGGGGAAGCATTTGAAGTTGATTCGACTCACGTGA
CCGAGTCTGACGGAGTGTTTGAGCCTACTTTGTACGGATGCGCGAGTTCGAATCTACACCGAAGTGAATTCGTTGGTCTGGACAACCCATTGATCCACAA
TCTGCTCTTTGACAAAGCCTGGCTCACCGCCGACGTTGTACAGTTCATGAGCATCCGCTACGGCATCCGACAGAACTGCAAGTATCGATATCAAATCGCG
CAGGACAGCCGAGGTCGTACACTGTTGTTGTCTGGCTCGAAGGCGAACTTCAGCTCCTACGGACAGCTCTACGTGGTGTTGATCCTCATCGACGTCAGCT
TGCTGCTCCTGCACTTCCTCAGCTCCGTGGAGATCTTCACGTGGATGCTGCTACCAGAAGCTCAGGAGGTCCGTGATCAACTCAGTACGACAGTCTCACG
AACTGCCACTCAGCTCAAACTCTTTCTCGTGAATGGGATATCGGCACACCGACGGAGCTCTTTGTCGTCGCCTGCAATAGTGTCTCCCTCAAGTGGACAC
GAAGAGCATCAGAATCACAATCAGCCAGAGGGTCTGCTGGAAGAGAACCTCTTTTACTCGTTCTTCTCTCGCTCACTCTACCGAAGCACACTCGTGGTCG
TCGTGACAGTCGTCACCCAGCTGATCTCGTGGCTGCTCGTGATGCCCAACTCGGTCGTATGGACCTGGAGCGACTCGGTGACCCAGAAGTTGCAAGCCTA
CTTGAGCAGCATCCGCGTCTGGGTGCTGATCCTGCTGCTCACGAACGCGCTTTGGAACGTCGTCGTGCTCGCGAGCGAGGAGATAGCGTACAAATTCGTG
AGAGGCACGTTCATCTCGAGCTTTGAGATCCTGCTCATTGGCGCCATGGTCTCCTTCGTGCTGCGGGACAAAGTGTTTGCGATGTGCGAGATCAAGTGGG
CGATCGAAAAGCAGCGCGTGTACGACGTGACGTCGTTCCCAGGGTTTCTGGCGCACGGCAATACGTTCAGCCTTGCGCAGGACTACGTCATGTCGACGCC
CGCTGACGTCTTCTGGGTCATCTACGAGCCGCTGTTGCACATCCTCGCCTGGAGCTTCGTCGTACTGATGCTTTACGCGGTCGCCAAGTTTGTGGTCTAT
GCAAAAGGTGACGTCTGGACTGCGTGCGTGAAGGGAGCGCTCACTAGGTCTCGTCTTGTCCGGAGCCTTGCGGTTGTCTGGCCAACCAGCAGCAGCAGTT
CGTATCCCCACCACCTGGCGCAGCGCACGGAAGAGGAGACCTCGCGAGCGCACTCCAACAACAAGACCCACAGCAGCACACCTAAGCAAACGTCACCCAC
TCAACAGACCGCCGAGCGAAAGTACGCGCGGTCGCAGATCGAGCAGTTGCTCGACTGCCCCGTGCGCGCCAAGAGCCTGATCCGCAACACGCTCCAGATG
GAGACGACCGACGCCGACACGGGCCGCGTGCATATCTCGCCGAGCTGCTACCTGGACTTCGGCGTCATGATGCGCGGCGGCGACGTGCGCTCGCGCATCT
GCTTCTCGAACGTGCTCGTGCGCGCGCGGCGGCCGGAGAACGAGCTCTCGATCGCGCTGGAAGACCATCCGCAGATGGCACGCCGCCGGCCGAGTCTGCA
TCCACTGAGAGAGCTTGCAGTGCACTCTGGTCCTCTCGCGATGCGCAAGCGCTCCTCGCTGTTGTCTTGGAACTCTTCGGATACGGTGCAGTAGCAGCAG
CAGTAGCAATAGCACAAGCTCGAACGCAGAGGCTTATTGGACTATGGACGTGCTGAGGATCTGAAAAATGAATATTATTGCTACAATATCAGAGTAGATT
GATTGAATGATAGAATGAGTACCGAATGAAGGGCTACGTGCCGCGCGCGCCGAGTTTCTGCATGAGCTTGGAGCCGGCCTTGGGGCGGTTCGGCGCGCGC
GGGTTCAGGCGGCTGAGCTTGTTCGGCTCCAGGTCTGCGCCAGAGCTCTGTCATGAAGAACAAGCGCCACACATCAGCCCACATACAGATACACACGGTG
ATATCCATGAACACATACTGAACATTCCGTACCTGTCGCGGTCGCTTTGGAGGCTCTGGTCCGCTACTACCCATAGCCGAGCCGTGCTTGCCGCCAGGAA
CCGCTCCCATTCGTGAGGGCGCGTCGTCCTGCTTGCCACCGTTACTATTTCCGTTCTTGCGCAGCTGGCGGTGCTCCTCCTGGGCCTCGGCGAGCGTCGT
TTGCCAGAGATTCTCCCACGCGCGCTCTCTCTTGATGGGGTCCATGCGCACGGGGCGGTCGTGAAAGAGCGTCAGGATCTCGCGAAAGTCCATCTTCTTC
TTCGCCACGGCCGCCTCCTTCGCGAGTAACTCCACCTCTTCGTCCAGCTCCAACTGTGGAGGTGGTGGAGNNNNNNNNNNNNNNNNNNNGGCGGCGGGGG
CGGCGCCAGCGGAGAGGACGTCGCGGAGCCGCTCCGCATCATTTTATGGAGCTTGGATGCGGAT