Description :
From Genome Similarity Track
Location :
contig_5:71886- 87521
Transcript NameFunction/comments
g1617.t1ABW71831.1 putative RNA helicase [Phytophthora infestans
g1618.t1CCA17628.1 putative RNA helicase [Albugo laibachii Nc14
g1619.t1hypothetical protein
g1620.t1hypothetical protein
g1621.t1hypothetical protein
g1622.t1RAW37262.1 hypothetical protein PC110_g6472 [Phytophthora cactorum
g1623.t1hypothetical protein

Sequence
15635 bases(100 bases per row)
CCAGCTAGCCGCCACTACGAAGTGAATACGTCACGCACGGAACGTTTACCAGCGACGACCGCCGCCACCACCGTATCCACCACGGCCACGGCCTCCACCA
CCACCGCCGCGACCCACAAGGTCACGCAGTTCACGCGGCACCTCCTGTTCAGCCTCCTCCATGATCTTCACCAAAGGTCCAGCCAGTCGACCATTGTTAC
CGGGCGTGAAGAACGAGATCGACGTACCCTTGTTACCGGCACGAGCCGTACGACCGATACGGTGAATATAGTCCTCAATGTTCTTGGGCATATCGAAGTT
GACCACGAAGCGGATGTCCTTGATATCCAGACCACGAGACGCCACATCGGTAGCGACCAGGATCTGAGTCTTGCCGTCCTTGAACTCACGCAGCACGTAG
TCACGCTCCTCCTGCGATTTGTTACCGTGAATGGCCTTGCACATGTAGCGAGTGTCACGCAAGTTGCGGCTCAGCTCATCGGCTCCACGCTTCGTCTCAC
AGAAAATAATGATACGTCCTCCCTCGTAAATGTCGCGCAGGTGGTCCTGTAGCGCAGTGTACTTCTGGTGGTCGTCCATAACCTCAACGATCTGCTTGAT
TTTCTTGTTAGCGGTCAGTTCAAGAGAGCCCACCGTCACTTGAATGAAGTCCGTCAGGAAGTCGTTCGCAAGCGACACAATCTCCTTAGGCCACGTAGCC
GACCACATCAACGTCTGACGGTCGGGGCGGATCTGGCTCACGATCTTGCGCAGCTGCGGCTCAAATCCCATATCGAGCATGCGATCAGCCTCGTCAAGAA
CCAAGTAGGTTACACGGCGCAAGTTCGTCTTGCCCATGCTCAGCATATCAATCATACGACCAGGCGTGCAAATGCAGATCTCCACGCCGCGACGCAGGTC
CGCGATTTGGCCACCCTTGGGGACACCACCGTACACACACGTATTCTTGATCTTGGAGCTAGCGCCAAACTTGTTACATTCCGCCTGAATTTGCACAGCG
AGCTCGCGGGTCGGAGCGATGATCAGAACAATCGGACCGTCGCCAGGTTGCAGGTACGGCTACAGCATAAAATAAAAGCACAAAAAGTTAGGAACCACTT
AGATGCAATCGAGCATATGAAGTTGCACGAGAAAGCAAACACAAGCGAGCGCCGAGGGATTGAGGTGTTCGCGTGCTGCTCTTTCTTCTGGCCACCGCCG
ACAACGCACCAATGCATGTTTCGCACCGATTGATCGCCGAGAAGACGCCGGTGGTCGTCGAGAAAGCAGCCAAGATTTGCTATCTGTATGCGTGTCGATC
GTGCCGAGCCAAACAGCCGAAGCCGTCGTAGAAACTCTCTCCGTCAAATGTTCGACCGGCACTCCAACACAGCAAATCACGCTTCGAATCAACTGAAGTG
ACGAAAAACACGCGAATGCCGCTTACTCTAGGATCGCACAATAGCTCTCCACTAAACGAGCATCCGTGTGGATCGACCACGCTCTGAAGACCGTATCCAA
ACCCCAACGCCTCACGCGTGTGACTCGCTCATCGCATCATATGCGCGAACGATCGTCGTGTGCTTGACACAACGTTGCTAACTCCTCCATCAGCGCACCA
GCGCCACGGAAGATGCGTCCAACAACGACCAAAAGCCTCTACAAAGAGTCTGCTTCAAACTACGAACCTGTGCGTTAATGTGCACGATCGCGGGCAGCAA
GAAAGCCAGCGTTTTGCCGGATCCTGTCGCCGAAATGCCCACCATATCGCGTCCTGAAAGCGCCATCGGCCAGCCCTGGCACTGAATGGCCGTGGGCTTG
TCAAAGCCCAGACGCACCACCTCCTCCAGCACGTACTCGGGGAACGAAGCCTCTTCGAACGACAGTACGCACTTGGGCACGCCCTTGCCAGACACGATAA
TCTGGTTCTCACGCTTCCACTGATCGTACTGATCCTCAGAGCGCTTGGTTACGTCCGGATGCTCGTAGTAAAAGTTTTTCTCGAACACCGGCAGCTTCGA
CATGTCCCACTGGATGTGCGTGTCCAGATTGGAGCCGAGGTCACCGCCGCCTCCACCGAAACCGCCACCTCCCCCACGGCCGCCGCCGCCACCGTATCCA
CCGCCGCCACCGCCTCCGTAGCCACCGCCACCTCCATAGCCTCCGCCGCCACCTCCACCACGAGAGTAGCCGCCGCCGCCACCACCGCCGCCGTAGCCAC
CACTGCTGCCTCCGCCGTAGTCACGACGCGAGGAAGAGTCGCCGTATCGGTCACCGCCGCCGCCGTACATGATCAAGAGTGATGGTTTGCCGCTTTCACT
TGCGCGCCACGGGTCGTTTCGACGAATGGGCTGAGTGCGCACTGGGGCGACAGGGGGCAGAGAGCGATCGCTTTGGGCAGGGGAACGGTAACAGGCGGCT
TTTGGTTGGCTGACGGGCGGGCGGCTTTTCCTGCAATCAGGTGTCGCAGCTCGCGCCATTCGTGGAAAATTCGCATAACCGGCCGTGATTGGACGAAACA
AAACGTTTTTTTTTAAAACGATCTTGATGGCTCAAGATTCTTGAGCCATCAAAAGACAAGACCGCACGAAGATGATGGAGAGCGCATGAGCCCGTTGTAT
TGTGCGTTGCAGTAAGCGCAGAAGACGGTGGGGCGGGGTCCTTGCCTCGGTCCGAAGGGTTTACTGGGATGATTTCGCACCCAAAAGTGCGTTCTAAGCC
GCCTACGCTAAGATGGTGCGCTCGTACGAGGCGAACTGCTGGTTGGCCTCCGAGATGCTCACCTCGAGCTTCCGAACTCCACGCTCCTGCAGATTCGGTA
GTTCAATACATTAAAGGGTCAGTAGGCAAGCTGGAGTAGGCAACAGATAGTGGCATAAACATACCAGGAGCGCAACCAGCGTGAATGCGTCCACGAGCTG
GTTGCTCTGTTCCAGGCAGCAGAGAGATAATTGTGAGATATAGACTTCCGCGTAGGATTTCAAACAGCAACCGCACGTACGATGTAAATGGCAAGCTCCT
CCGCCGAAGAGTGCACAATCGGCAGCAACGAACAATCAGCTTTCGGGAAGCTGGACACATGCACAACACTGTTTGTTAGATCCGCTGCCTCTACGCCAGA
CGCCAAATAATCGGCCACCAACCTAAACTTAGCATTATCTTCCGTCAGAATGTGTACGTTCGTGCCATCAAACGAAATCTGCGTGACACCACACTCAAGT
CAGCAATCGGCGCACATCCATTATCCCAACAAAATCACTCCCTCACGTTCAACGCGTCACTGTTCATGGGCACGAGGAACGATTCGTTCAGGTCCTTGCA
GATCACCCGCGAGATCTTCTTGATCTCACCAAAATCCAGGACGTAGCCGTCGCGGCCAACCTGTCCGGTAATCGTGACAGCCAAACGGTAGTTGTGTCCA
TGGAGTTTCTCACGGAATCCCTAAAATACGCACGCAGTAACCAAACATCAGATACTCAACCCTGCTTGGAACTGTACCAATCATGCTGCAGCCGTACCTT
GTAAGCGATGAAGTGCGCCGCATTGAACTTCATGTAGTCCTTCGACACGTGTACCTTGAACACTTCGTTGTAGCCGTTGCCCATCGGGTTGGGTGTAGAC
AAATGAGTCGGCATCGCAGCTACCACAGTCGCACCCGTCTTCTGCAACGTTCGGGCGGGCATCGAGGCGTCACTGCTCAACGCAGGAGGCGAGGTCGCAC
TGCTTCGGAGCGGCTGGATCTGCGCCTTGATTTCCTCTGGAGTCTTGACGCAGCTACGAAGATGGGACGCCCAGCGGTCAACGTTGCGGGATGAGATTTC
CTTGTCGCAGTAGCAGCACTTGACGATGCCCTCAGAAGTGCCACGCGCCACGTACATTTTGGCGATAGCCTTCTGCTCCGCGTTGAGTTCCTTGCCCATG
TCTGTCGAGTTGTGCTTGCGTCTCTTGGTGGTTCCGGTCCCGGGTAGCTCCTCGATCGACGGGGTAGCGAGGCTCTGCTCTGCGATCCGCTTGAGCTCCT
CGTCGTCAACTGACATCCTCAGGCGGGGAAGCACTGGACGCTCGGTTTGAAAATCAACGAGGCTTTTGATTGGTGGATAAATGTCATATGGTGTCTGTCA
CACTATTTCAATGTGAAACTTTCAACAGTGGCGGAATTTTGATGGCCATGGTAAAAGAAAATGACAAAGTTGAGGCGAATATATATATAGCGTGCCAGCA
ACTCGCCAGTGCGGTCGTGCAGGCTTTGCGGCATGCTGGCGAAGGCGCTCTATTGGTCCGAGACCGCACGCGGCACAACGCTCAAGAAGAAGTTCATGCT
CACGCCTAGCAGCAATCCGACCTTCTGCTTGCGAGGGACGGAGCGGTCAAGAAGCTGGTACAGGGCACACACAGCTCATGTTAGTCACCGCGTAAATCAA
AGAACGGCAGCGAACGGAACTCACCATCAGCAGCATAAATACACCAAGCAGGAGGCCCATCAAGAACCCCCACAGAAATTCAGTGCCGGTGCCTTCATTA
TCTGCTGCCAAAATGGAGTTGTTCATGCCGTTCATGTCGATCTGCGTATCCATCGCAATGCGAGCCGTCGGTACAACATTGAGCGCTAAAACACAGCAAC
AAGAAAGTGAACGAACAAGTCGATCTAGCCAAAATAAACCGTTGCAAAGTTCAAGAGAAGCTCATACCGAACTCCGACTGAGGTCCTTGTGACGCCATCC
ACTCCTCTTCCAGACGATATATCCGGTCCTCGCTACTCTCGCCAGGGACGCGGTCCGCCTGGCTGATATACACCGAGAGCTGAGGGTAGAAATACAGACG
CAACGCCTGGATTTCCTCCCGACTGAGCCGGTCACGGAGTCTGTCAAAGCCTCTCCGACCGGACGGGTCGTCTCTCTCCTCTGGTTCGCTATCAGTGGCT
GCTACCTGCAACATGGTTACGCAATGTCTCGTTAGCAGTGTGTCCACCAAAATGGACAACCGTCTCTCCACATCCTCGCACCTGGTTCACCACAGCTTTT
GGGGGCGCCGAGCTGATGGCGCAGTGTACAAAGTCTTCGTTCTTGACCTTGCAGCTCTCGAGTGACGCCTTGTCGTCCGACAGCATCTTGCCCTGGTGGA
TCAGCCGCAGAAATTTGCCCTCAGCATTGGCTTTCTTCTTCACGAGCTCCTTCAGGTCGCCGACGCTTGCGGAGGGCGCGATCTCCACGCGCAGCGGCTT
CTCGCTCAGCGTCTTGACCTTCAGCACGATGGTCCCGTTGTTGTCTTCATGGATCATGATGCCCACGGCGTCATCGGACAACTAGAATAAAATAAAGAAG
ATAAGTTCAAATAAAATCGGAAGCAGCATGGCACAGCCTCTCAGCTACGAGTGTGTACCAGCGGCTTCTCCTCCGTGATGTTCTCGGTGAACTCCGGCTC
CATCATGCTGCCTGGATCGACCTGTAGGCGCTCACACGCCTCCCTCGACCGCTCAGCGTCCTCCGCACTATTTGATCTGTGCGGTTTTTCTCGCCAGGGC
TTTTTTATCAGCTGCGGGTAGGGATGTGCGAGCCAGTTGGATCTCTCCACTTCTACTGGCCAAAATGGACCTCTGTGTTTTAGCCAATCCACGACGTTAC
CGCGAGAATGAACGCCAATTCAAAATTTGTCCGTGGCTGAAGCAATGCCCTCCAAGGTGCAAGACGCGGCGGGTTCCGAGAGCTCCCCCAAGCCCCCTGT
GACAGCTGAATCTGGAGCCAAGAGCGAAGCCGTGCAGGTGGCCGTGCGTGTGCGGCCGCTGAGCGCTAATGAGGCGTCACAGGGGTCGGAAACGTGTTTG
GACGTGGTTAATGGCAGTATCTTACTGGCTGAAAAGCAGTTTGACTTCGATGTTACATTTCCAGCGACGTCAGATCAGGTCCAGATGAAGGCTTTGGTGG
CTAGTTTTTTGTGTCCGTTGTTCTAATGCTTGGTGTTGTATTTGCTGTAGGAGAGCGTGTACACGACATTGGTAGCGCCTATGGTGGACCAGTTCTTCGC
TGGCTACAATGCCACAGTGCTCGCCTACGGGCAGACGGGAACGGGCAAGACGTGAGTGTTGGCGGTAGTCGGATGGTGTGATGTGAGTGTACTGATAGTT
TTGTATGTTGAATAGATACACTATGGGCAACGAGTTCGCGTCTAGCGTGGTTCCCGTGGAGCGCGGCGTCATCCTGCGTGTGGTTCAAGATGTGGGTGAA
GAAATCATTCACGCAATGAGTAGGATGGTGTTAATGTCAACAACTCATGCGCTTGCAGGTTTTTGAGCGCGTTGAGGCTTCCGCGAATCCTCAACACTTC
GTAATCAGGCTGTCATATTTAGAGGTGTGTCGCGTGCTCCGTTTTTCTCTGTAATGGATCCATGTTGTTCTAATGATAATCTGGGATGTAGATTTTAAAC
GAGGAAATCCATGATTTGCTGAATGTAGCAAAACCTGAACCAAACCCACCTCCGAAGAGTACGGGTCTATCTGTACGCGGTGATAGTGACCGTGGGATTG
TTGTTTCGGGGCTCAGTGAGCATGTCGTGAACACGATGGATCAAGCTGAAGAAATTTTGCGTTCTGGCGCGTTAGTTCGTGCCACAGCTTCTACTACCAT
GAACGCTAGATCCAGTCGCTCACATGCAATTTGTACTTTCGTAATGGAGCAGTATGGAGTCAGCGCATCGGGAGGAGGAACGGAAACACGGCTTTCGAAG
TTCCATTTGGTTGATTTGGCTGGCTCTGAGCGGGTCCGTCGCACAAACTCAGAAGGTGCCCGTTTTAGGGAAGGCGTCAACATTAATCGCGGGTTGCTTG
CGCTCGGAAACGTTATCAACGCGCTATGCGAGCGCAACCGCACAAGTTCGCTAACAGCTCATGTGCCATACCGGGATTCCAAGTTGACTCGACTACTCCA
AGACAGTCTGGGTGGTAACAGCAAGACACTGATGATTGCTTGTATCAGTCCTGCAGATGTAAACTATGAAGAGACTTTCAACACACTCCGGTATGCGTCG
CGAACGCGGGAAATTGAGAACAAGGCCGTGATTAACAAGGAGCGGGGACCTGAGAATGAAGTGGTATATCTCAAACAGCAGCTGGAAATTGTGCGACTGC
AGCTGTTACAGCAAACACAAAGTGCGTCAAGCAGGCCTGGCCGACTTACTCCCCAGGGCTTCAGTGCGGCTAATGGCATTGTGGAGAGCACGTCGGGCGT
TAGTGCTCTCGAGGCAGAAAACCGCAAGCTGAAGGCGGAGTTATCGCTGGCCAACAATGAAAAGAAGAAGTGGAAACAGATTGCGAATGAATTGACGGAC
AAGAACAAGAACGAGTCAGAGTTTGCACCAAGCAAGGCTATCGGTAGTCATCTGGATGTGTCGGCACCCATCAAGAAGCATGGTGCGGTTAACGATGGAG
AATATGGCAAAAGTGGGCCTCTGTCACGGCTGGAGCAACTTCGGAAGTTCCAAAGCCATAAAGTGAAGTCACAGCACAGCAAAGATGACACAGCTGTGAA
GCGAAAGAATGGGGACTATACCCCGGCAAACATGCACACTCGGACGTTGATGTCACCATCCACCAGCACTCCGGACACTGAAAGCAAAATTTTGAATGCA
AGGATGGCTTTAGTACTCCCTTCCCATATCAAGAGAAGCAGGGTCGGTGAATCTGCTGCTCTTATAATGGGGACAATTACGAAGCTTTTACAGCAGGTGC
TAGCGTCCCAAGAATCGATTTACAATGCAAAAGTGGATGTCCGAGTGAATCTTGCAAACAGAAATGCTCTGGCGCTGGAGATTTCGCAACTCGAGGGGTC
ATCCTCAACAGAAAACACTGAGAGGCTGGCCAGGTTACGAAGTGATCTCCGAAGTAAGTCTGCTAATATTCGGCTTCTCCAACAAAAGTTGGCGAATGTC
GGAAAAAACGTGTCGCTGCCGTCGGGACTTTTTCCCATCAGGTTGGAAACCTGCCATGACTTGATCCGGCATCTCATTGAAACGTTAGTAGGATTCAAAG
AGGAGTGTATGGTCCTCCAGTCGGATGCAGCCAATGAAAGGATTATGAGTCAGCAAGAAGCGCATAGCAAAGTCCAGGCACTGGGTAAGAGATTGAAAGA
GGCATTGAAGGAGATGCAAACTCTACGGGAGCAATCAACGAAGAAAAAGGCAGCCAAGAAACGAAAAGCTCGAGAGTCGTACGAAACGATGGATACGCTG
TTCAGCAGCAGCAGCGAAGAGGAAGACAATACTGAAGCTGACTCGGACTATGTGGATGAGGAAGTCAATCGGAATGAAGGCAACAAGAGGAAGAGACGTT
GCCGTACGCCTGTGTCGGAAGGGTCCAAGAGAGTAGATGCTATGGACGAAATCGATGAACTGCTAGAGACCAGTGCAGCCACCTGTTGCGCGTGTTACGG
CAAATGTGCAACGAAGGCGTGCGCTTGCAAGTCGCAAAATCGCATCTGCAACAACGAATGCTCGTGCAACTCAAACAAATGCCAGAATCGAGGGGGCGAT
GACAACACTGGCGAGTCTTCAGGTGTCGTCCATGACAGCGACGAAGTTCTTGGTATGACCGTCAGTGATGTAGCTCGTTCAACTCCAAAGCGTGGTGCAG
GTGATTTTGCCTCGGAAACGAGCAGCTCGACGACTTTGATGAACCCCACGGTGACGACATATACAAGCCCCATTATTGACTTAATGTCACCGTGAGCACG
CATTTCGGATCCTGCTGTTCAAAAACATTGGCGAAACGAGAAGCAATACGCTAGAAACGAAGCAACAGACACATCACCATACTAAATGGAACATGTACGT
GAGGTCAGGTAAATTCGTGTATTATTCGTTCGAGGTGAACTCCTTGTGCGTGTCGGCCATTCACCACCGCCGCCTCGCTCAATAAGAGCGACACACAATC
TACACCGTTAAGCTTGCTCTCATGATAGGTCCCCAAAGAGATCCATGTCTAGTGCTTCAGGTTTTCCCGCCATGTATTCGGTATCGTCCTCATCATCGGT
GTCAGAGGAGGCATGATGGCGAGCAGCCACCTTTTCACCTCGACGAGTCGGCGTGCGGATGCTCACGCCGTTCGAGTTCTTACCGTTGCTGCTTCCAATG
CTGCCTGTACCCTTGTTCTCACTCGTCCTTGACCTCGTGCGGATAACAAGTGCAGCCTCCTTGGGCTTCTGATACTGGTATGTGTTGTTGCCGCTTGAAG
TCGAAGAGTATTTTGCGCGCAACGCGCGAGCCTTCTCCTCACTCTTCTTCGCCAAGAAATTCTGAATGAGTTGGCGCTCATGGTTACTCATGTACGACAT
CTGCACGTCCGCATCGAGCACCAGGAAAAGTTCCTGGTATTCGACCTCCTTCTGTGCAAATGATGCAGCGGGCACGAATTCGTAGGAAACCACTTCGAGT
ATATCGATTGAGTCACGATGGTACGGGATACGTGCGAAGCGCAACCGCTCAGCGGGAATTGACAGCGCAGCGCTAGCAGCGTCCGCCAAGCACGTCTCGG
GATGGTTTTCCTCGTCTGAGGTTGAAATCACCACCTCATGCCGCATGTTCTTGACGAAGCGCCACGTCCCGCGGTTCACATACGCAAATTCAACGATTCG
GTGGTTGACTTCTGTGGTCTCTGGCTCTGACAACAGTTCTGCAACAATGCTTCTTCCTTCGTACACCGCAAGTTTTGATGCCTCCACGAGTTTTTGACCA
TCCACCAGCACGCTTGTCATTGTGCTTTGACGTAGATCGCGAAGGCGGACGTGGGATGGAGTCAAATTACCGCCATTTGCATTTATCAAGTCCTTCTGCA
CTAGTCCATTCCAGACCTTCTGACGAATATCTTCCACGAGCATCTCCTCACTAATCACGATTTGGTCCACAAATGTCAGCAATGAATCATCCTTTCCTGT
CGCCACCAGCACCTCATCAATATCAAAGAAATCGTGGCTGTTGCTGTCATCTGCTGATGTCACGGTAGGTTGACCCTGGTTGTTGTCCTCACCCTCGGGT
GAAACGGAACTACCGTTGGACGGATTGTAGAACATCAATCGAAAGTTGTACTCCCCCGTGTTCAGCGGGGTGCCCTCCAAAGCGAAGACCGTGTGGTTGG
AGCCGATTGACAGCTTGGATAGAGTACTATCGATAGCCTTGATTTCTACACCAGCACTGTTGATGCCACGTAACAGCTTGAATTTGTTCGAGGGCAGGCC
AATCTTAGCACTAATTCGCTCCTTTAGCGCACGGATCGTCTCCCGCCTGTCAATGCGAATGGGCTCGGCAGGGCTCGTCAAGTACTTAAAGTTTACGGTA
ATCATGTTGGCCTCACGCTCAAAGAACGCCTCAGCAGGGGACGCAAGCGTAAGATCTGGTGTCTCCTCGAGGTACAACTCCGTCCCATTCACCAAGTGCA
GATCCATCTTTAGTCGCAGGTTCCGTGTGCGCTCTTCATCGTTTGCATTCAGAATCTTGGCTGCAGAAATGCTGTATGTGGTTGCGCTCTTCTTGATGAG
GCGAATCTTCTGTTCAGCTGGGACGGAGAACTTTTTGGCGATCAGAGCACAGAGAGAGACTATGTTTGCACCCTCGTCCACCTGAATGCACCTTGCCATG
AACGAGCTCTGGAAGGTGTTGCTGGTGCTGCTTGTAGGCTCAGATTCTGGATCAACAAAGCGACGAATAAAGAGCTGGAGCTTTGTTGGATCATGATCTT
CCCATTCTTCGTCATCGTTCTTAACCTCGAGGAACATCTGCTGTCCGGCATAGATACCCAATGATGATAACGTCATGTCCTCTTTATCGTTGTACGTGTC
AGATAGCAGGCAGTTATAGTCGTTGTATCCTCGCAATCTCACGTTTTCTATCGAAGGTACAACCACGTCCTTCTCGATCGCAAACTCCTTGTACGCTGTT
TCAAGTGCCTCGCGAATAGTCGAGGTCTTGTAGACGTAGATGGCCTTCTCTATGTTTTTAGGCCTGGAACCCTTCATAAAAAACTTCACTTGCACCTTCT
TCGCCATCTCAATCCGCTCCTGCTCAAGTTTGCGAATCTTGTCTTCATCAGCGTGAATCTTGTCTTTCAAATATTGTGGAATACTATCCGGCAAAATTAC
ATTTACGTTCTTCTCTGCAGAAACCAAGCGATACAACAGCATGTACGCACACGTGCTGTAGCGCATGCTGTAACCAGAACCACTAGCGCCTCCAAATGCA
GTCTTAAGCTCTGTGTCTGAGATCTCACTCACATTGGAGTCATTGAAGTTGTACCACTTGCCCGTCTCCAGGGATTTAATGTACGCGTAGTAGTGCCCAC
CCAGCGCGCTGCCAGAGTGAATGAGCACCGAGTACAGCTCATACACATGCGGCCCTGAGCGCTTAATCATGACCTCAGGGTCAAATATGGAGCTCCACGT
GTCAAACGAAGCAGCACCTTCCACATCGTCTTCCTCCTCCTCCTCCTCTTTTTCGTCATTATTCACAAACGTCATCGGCTGCGATTCATCCATAGAAGAC
AGGCGGCGCATACGTTCACCCATAGCAGCAAGTCCAGGCGTTGGGGGAGGAGAAGAAGGTATCGTAGGCACTACATCCTCAGATGATTTAGGGTGGTTCT
TGCCCTCCAACACGTGACGCTCCATCGACATTTTTCTAGCAATCTTACCCCGTACCCCTCCGTTCTCGTCGCTCACGTACGAGTTCATGTCCAGGTACTT
GGGGAACGTCACCTCGTTGTGTAATTTAATTCGGTTCATCGTAGCATAGTCAAAATCAAAACGTTTCAGCTGCAGCATCAAAATGTACGGCAGCTTGGAG
AATTTCAGTCCCTTAATCGCGTCACGTTTAACCTTGCATCGGTCGCACATCCACTGGTTTTCCTTGTCCAGCACCTCCGGGCGCAAAAACAGCTCAATAG
CCTCCTCCACAGTCTTCATCATTTCCGTCGATCCAAAAGGTCGGATCACAAGCGACAAATCCAAAAAATTATCAATCCTCGAGCTCTCGTATCCACACTC
ACAGCATTGCACATAATCCTTGAGCGATCCCTGGTACAAATCATTCACAAGAGTCTCGTTCACCGTGCCCTTAAAAGACTTCTCCAGTGCGTCCAGCAGC
ACTCGACAGAGCTCCTGCACATCATGTTGCTGGAACACGTCAGCTCCTGTCCAGCCAAAGCTCTTAGTCAGAGCCTTGGTAGAAATAGAGTCCTGTGTCG
TGAGTTGCAGCTTGGCGAACAGGTTCTGGAGTTGCAACGGGATGTTGTCTTCGTCGGCCTCTTCGTCGCTGTCCTCGTCTTCTTCTTGCTCGGTCAGCTC
CGCTTTCTTGGCTGCATGACGGCACGTCCAGTTGTACAGGCCCTGACGGAACTCGGGCGTCATGAACATGCTCTGCAGAAGACTGTTCATGTAGCACGTG
GCTCCCTGGTTGGACAGGCCAGTGAAGGCGTTCCTGGCTCTGCTGTAACCCCCAGAGCTACCATAGCTGCTTCCACCATTGCTCGTGTAGCCCGGCGAGT
CGTAGAGTCCCTCCAGCCCCGAAGAACTGTACGTCGTGAGCGCCGTGGACTGCACGCTGGGACTCGCCGCACTGTCCGCGTCGTCGTCGGCGCGTGGCAG
CTGCGTCAGCACGGAGGCCACCTGCGCACGGTGTTGCTCGCGAGATGTCGAGGCCTCGTCGTCGTCGCTCGAGTCCCAGCTCATGCCAGAAACTCTCGGG
GGATCTCCAGGTCGCCAGTCGCTCATGCTCAAAGGATTTTCGCTATTACGACTGAGATCTGGTGTGAGGGAGGATGTGGTGTATGTAACACAACATATAA
GTACCGTGGATAGAGTGACAGAAAGTGCCTGTTCGTCGACCACCGGAAGAAGGCTGAGACGTGTGGTGCTTTTGGCACTGGAATTGATGTTTGAGTTGAG
TATGCCTGAGCCTGGAGGAGTTAGCGTGATGATAATGGTCGGTGGTTGGAAAGATAAGAATGTGCTGACGAGACAAAAATGAAAACGAGGAGCGAGGGTG
AGCTCAACAGAATACAGCAGTGACTATGCAAACAGTTTCCAGTCTTAGATATCATCGCTTGTCTGACGTCGACGAGGTCCCAAGACTTACACCATGCGTG
GCGTGGGGGATCTGTTCTTCGCCAACGGCAGCTCCTCATCCGAGTCTTCCGAACCGTAGTTGGCTCTGTCGCGCTTGAGCGTGAACGTGTCGGTGAGGAA
GTCCAACTCGCCCGCGCGCAGCTTCTCTTTCCGCCACATCGTGTAGCACACGCCCATTGCAACGGCGTACAGCATGGCTAAGCAGCAGCGAGAAAAATAA
TTCATCCAACCACACCGACAGTAGCACAAACGCACCCCGACAGTCAATACGTCACACAAATAAGTCTCCACACACGACCAACACCCAATTAAAATTGAAG
GCAATTCCTACCGGCCTCAAAGCACGAGTTGGCCCCCGAGTTGGGTGTCTTGGCGTTGTGAATGTACATCGGCTGCAGCTTCAGCAAAGAACCGACCACT
ACCTGCAAATTCAGCACAATGTGGAGTCACCAGCAGAGTTAGAAACAGCCAGAACATCGCAGCAGAGCGCTCTGCGACCAGCGAAAGCGACATGGCCGTG
TACCAGGAAGACGAAGCCCATGAAGCTGAAGATGGTGCCGCACAAATAACCTGCAGCGGGCGCAACAGACATCGCCAGATAGAGCAGACGCAGGTTAATC
AACCGGGTAGCGAGAACACCGCGACTGAGGATACGTACCCCCTCCACTCATGCTGCCGTCTGATACTCCGCTTCTTCCTCTTGCGAATTGTCGATCCAGC
TGCCGTCTCCGCCCCTAGGCATTTCATCCAATGGGAGGACCACAAGATGGATACGCGGCTCTGAACCACTTTAGTGTGTCGAAACACCAAATAACGTATT
GCACACAATATTCTAACTTGAAGTTTACGTAAAATAAAGCAGGTCATCGCTCAATGCTGCATCATTGCCTGCTTCACTGTCATGGGCGTCGCCAAGAAGC
TGCGCGTGCTGTGCATGCATGGGTACCGCACCAACGCCAAGATCATGGAGGACCAGGCGCGCGGACTGCGCAAGGCTCTGGCGCCGCACGCCGAGTTCGT
GTTTCTGAACGGGCCCATCGAAGCCCGCGGACCCTCGGACGACGTCATCGAGACGCGATACGCCGAGCACAAGCCATTCTACGAGTGGGGGAGCTTCATC
GAGCGCAAGCGACCGCAGGAGTGCGACCCGGAGACGCAGGAGCTTGTGTACACCGACCAGGGCTGGTACCACGACTACGTGGACTGGGACGCCACGGTGC
AGTACATGGACGAGCAGCTACCGAAGCTCGGGCCCATCGACGCCGTCGTGGGCTTCTCCCAGGGCGCACAGACTATGACGGCGCTGACGATGTGGTACCT
GCACAATCACAACAAGCGCTGGTGGAAATGTTGTGTGAGCGTCTGCGGCCCAAGGGTGCGTGGGGCTGCGCTCCGTCCGCTATTTGAGAATGAGGATGGG
AGTCCTCGGTTGGTGCCCATGCCCTCGATCCACATCGTCGGGAAGACGGACAAGTGGCATCGAGGCTGCCACGAGATGGTGGACATGTACGAGGACCACC
CGGACGGAGCAGCACGCGACAAATTCGTGTTCGAACACGACACGGGCCACCGCTTCCCTTCCGGAGAGAGACACGACCAGCTCTACGAGGACGTGGCTCA
GATCATCCTGCAGCATTGCCAGTGAAGCAATAGAGGTGGGTCTGGAGGGTAAAAAGTAAATGCCAATGAACTATAGCTTTGCCCGAGCATTGTTGAAGAT
GCCGTAGATCGACTCATCAGCATTGAAGATAGTGGTCCGAACGTCAGGAGACTTCACATCTAGATTTGCGGCCGAAGCAGCTCGAGGACTTCTGAGAGAG
CTGCGCACGCTCAAACACACGTCCTCGATAATGAGAGTTGCGACGAAGAAGCTTCGCATTCTGTGCCTTCACGGCTACCGGACCAACGTGAAGGTGATGC
AGGATCAGACGCGGGCTCTGCGTCATGTCATGGCCCCCCACGCGGAATTTGTGTTTGCCACAGCCCCATTCAAGGCGCGCGGTGCCTCGGACGAGACGAT
TGAGCGGCTTTACAAGGACCATGCGCCGTTTTACGAGTGGGGCCACATCACCAGGTTGGATCGCCAGTCAGACACGAGCGACAACGGATGGTACCATCAA
TACGTCGGGTTCGACCGGGTCGTGGAGCACATCGACAAACAGGTGCAAGACCACGGCCCTTTCGACGCCGCCATCGGCTTTTCGCAGGGTGGCCAAATAC
TCACTGCGTTGTCGATGTGGTACCTGCACCAACGCAACGAACGCCACTGGAAGTGCTGTCTCATTTGCTCGGGCACCCGTGTGCGAGACGTAGGTTTGCG
TCCTCTCTTTGAACACGCTGACGGTTCGCCCAAGCACGTCCCAATACCATCCATTCATCTCATCGGCAAGAAGGACCCGTACTACAACACCTGCCACGAG
CACGCCGAGCTGTACGCTGCCAGCCCAAAGTTTGTGTTTGAGCATGAAAGCGGCCACCGATTCCCGTCTGGTGATCGCCATCCCGAACTCTACGAGAAAA
TCTCGGACATGATCCGAAAGCACTGCAACAATTGA