Description :
From Genome Similarity Track
Location :
Scaffold_685:7188- 8377
Sequence
1189 bases(100 bases per row)
ACTGTTCgAaTAACTGAGGcGTGacAGCTGtttcAAATTGATGGTTCAATTTGAATCATCTTGAGCGGAGGCTATGAgaTCTTCACTTGACTTGTAGGTC
GTtGGTAATTTTGAGAGTGAGCTTTATTTCTTACGCTTATCTAGATCCATCCTAACTCCCTAcGGGCCtAGGTCTCAATCTTGTGCCTCCTAaCCActCA
CCCGTGCGGTCCGGCTGGCCTTGCCTCgCGGTTCAACCGCTGATCCCGGTTCAGGCAGGGACCGAGGGATTGGtCCCTTGACTGAGCTCCCCcGTGGGTG
GCTGAGCGTGGCTGGGGCTGGCTGACGATGGAACAAGTCCAGCCATGCCCTTGAAGTCACCTCCATGCTCAGGCATGGACTCCCTGCCGTCCAGTCTGCT
CGGCCAGAACATGGCCatGCTCTCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGATGGCGGAGTGTCTTAGAGGTCAGAtCcTTTGTGAGAAAGTCT
GCGACTTGATTCTCCGATGCGACATACTCCAACGAGATGACACCATTCACAATCtGgTCACGAGTGtaGTGATACCGGATGTCGATGTGCTTGGTTCGCG
CCTGGTAACCCGTATTCTTGGCCAGGGcaTAGCACCTTGgTTGtCcTCATACACCGTTGtcGGTCCAGCTTGCTCaGAACCcACGTCCTTGAGTAGcatC
cGCATCCACACAACCTCCTTGATGTATTCGCTCAGTGCCATGTACTCAGCTTCAGTAGAGCTCAAGGCCACTGACTTCTGGTAGGTCGC