Description :
From Genome Similarity Track
Location :
Scaffold_133:7185- 13802
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_133-fgenesh-gene-0.1Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_133-snap-gene-0.24Phosphatidylinositol kinase (PIK-L4)

Sequence
6617 bases(100 bases per row)
TGCAGTTCCACGCCGCGTTCTCGACCAAGCGCGAGGACGAGGACCGTCAGACGCTGCCACCTTTGCAGACGGTGGAAGAACTGATTGCGGAGAATGAAGC
ACTGAAGAAGGAAGTCGCCGAGCTTAAGGAGAAGATCGCCAAGGCCAAGCCGGGTCTCATGGCCACGATTAAGCAGTATGGTATGCCGTTCTTCATCTGG
TGGACGGGTCTTTACTTCGCCACAGGTCTCGGCTTCTACGCTGCTTTCGACACGGGACTGCTCAATGGCGCGCAAGTGATTGACTTCGTCATGTCGCTCG
GCCTCGACCGTCTCATCGACCCTTCGCGCCTCGACCCTAAGCACGGTAACCTCGCCCTGGCGATCATCGTGAACGAGGCGATCGAGCCAATCCGCTTCCC
TTTCGCGATTGCAACGATCCCGATGGTGAAGAAGGCTTtCGGCAAGAAGGAAGAGAGTGCGTAAGTACTGGATCGTTtCCCcTAGCTCTGAGAGTACGAG
TAAGCGATATGCAGTAATGCAACTCATGTGATAGATCATTGTCTCTCTCACTCTCCATTCTAGCTTAGAGGAAcGGCATCCAACCGATGTACATCTGCGC
GAGATTCTCGTGTGCGGTTGCCTCgTGTATCAATTTATCGACTTGCCCTTGCACAGACAGCGGCAGCGTTTCATTCTCTGGTAGTAGACTTCGATGGGAC
GATGATACGAGAGGGCGGATCGCATCACCCAAATTGTAGATGCCACGAAGACGGTCGTCGATAGTCTTCAAAATAATTCGAGTTTCTTCTTTGCTCCGGT
CGCTGGGGATATCGGCAATGCTCCGCCCTGCTGTACTGCTTGCCATTCCCTGTGCGTTTTTGCCCCGACGACCCCACTCTACAAGTGGATCGTGGATGAA
AGACTCCAGCACACTCCGTAGCGTCTCTTtGTTGGCTCGTAGCAACTCCATCGTCACTTCACACACACGCCGAAAGACCCCTTCATATCCTGTAATCCCA
AATGCGTCGATGATGTTCGGAGTTAACCGGAACGGCACTATTTCTGGTTTGGCgaGCTTCAGTCCTTTGTCGAAAAGACAGTCAAAATCGACATGCACGC
ATTCACCGTTCGTGCAATCGATGAGAATATTCTCACCGTGGCGGTCACCAAGCCCAATGATGTGACCGACCATCGACCACACAGCTGAGGATCGTGAGAA
CGTTAAACGAGCTTCAAACCATGCCGTTGGATCGGAGAAGTTGTTTGTAAACCATTGGTGAAAACGCGGCGTGAACGTAGGAAGACTCAGAATTTTTCTT
CTGAAGTACAAAGCGAGCATCACTGGGTCATTTGCATACTTCTTTTGCATTCCTAGAAAACGTTCTTTGATATCGTGGGTGAGTCGAACAGGCTGAATGA
AACCGCGTTCAGTTTTGTGGATTTGGCCGATAAGCTGTCGCATCGCTTTCGTGTGGCGCACCCATTCCATCAATCCGCTTTCTTCGTTCAAACAGACGAC
TGCATACGTGCGGAGGCGAAGTTTACGTTTTCGACCTTCACGATCTTTCTGCAGCAGCTTGTTGATCATGGTATTGAACTCCATCATGCGCGCATCCTTT
CGCAGGTCGCCAGTTTTCTCTCGTTTGCACAGGAAGGGATAAAGCTGCCCGTCAGTGCCAAGAACTTCGATTCGCTTTGGCTTTTCCTTCGTCATCATCA
CATCTGCTTTGTCGCTGAAAGTCTTGATGTGCACTTGAGAATGTGGCATGAAAGCTTCGTGTCGATTGTCATCAGGTGCAAGACCCGATGACGgAAGCAC
AGTATTGAGCGTCGCTTGAACTGGAACAAGGATACGTGTTCGGATACGACTAAGTCGAATATGAATTTTCCGCTGATTCGCAGGATCATGCCCAGCTAGG
CTGATAAGCTCTTCAGCAAGACGCATCCCTTCAGCAAAGCTGTTGGCGATTtCTTGCTGTCCACTCGAAACAAATTGCCGCTGTGTCGCAGCGATAATGT
CTCTCGCTCGGTTTCTGCGCTGCGAGTTCagaGAtcGAGACAAGCCCAaCAGGGGCCACATGGCCTGAGTCGGATATGTAAGAAGCACTCTCATCATGAT
TTTTTTCACGCCATCTACGACAATCGGATTAGGATGACAAATACGCGAAGTGACTTGAGGGAAGCATACAAGCCACTCATACGCAGGTAAAATCTGCGAG
GCATTTTGGATGACACTTGTGATGTCTGCCATGATTTGCTGCTCGGTGTTCGATTGGCTGAGCTCTATTTCGATGCTCCGCATTGCCTTGTTGGTTGCTC
CTTTGTTTGACCCTTGCTGAAGGAGCTCACCATACTCAAACCACAACGTCAGCAGCCGAGGCAAAGCTTGGAACAAATGCTTTGTCCCATGGCTGAGGGC
TAACACGTAGTTTTTCATGAGGTTGATAAGATGAGAGTGGAACGTGGAATCGATAtttAATTGAACATCGTCATTCCGTGACCCATTCGCACTTGACATT
GTTGTGGGAGCTTCGGGGTGACTAACACTTAGCAAATACTCGTAGTACTTCGCAAGGAAAAaGTAGCCTTTCTCCCACTTGGGATCAAACCTAATCACTG
CCTCGTATCTCTCAACAACTTTTCGACCCTGGCGCTGACCGGACTCTTGCATCCAGTTCGTGGCAAGAAGAAGGTTTTTAGCACAGTAGTGAGGATCTTC
GACGTTGTATGCAATTTTCGAGGCGTCAATATCTACAGGCTCAATGATCTGTAGAGCTTCGTACATTCTGTTTTGTGTCACCAGCAGCTTAGCTTTTTCT
AAGCTGGCGTACGGATTGTCAAGCGCTTCGGCATGCATTACAGCACTATTTGCCGTTCGGATAAAGCCCTCCTTCCTGGCCAACTTGGCGTAAGACAGCC
AATTTTGAGATACCTCCATGCGCAAATCAGCTTCTTCTAACATCACGCGACGCAGAGCAAGGATCGGATCACGAAACTTGAGTGATGGTGACAACAAATC
GTATCGCGCCTCCCAAGGGCACTGCTCCAGCCAACGCTgCcGTCGAACTTCTAACTCAAGATCCTTGGATTGCTGAACTGAGATAAATCCTAACTCGGCT
TCATGCAAAAAGTGAAGTTTATGGAGCAGAGgATAGGCGCGCTGATAAGACTCGGCACACGCTGCAGCTAGTGGCCCCATCAGCTCGACACGAGCCTCCc
GCAGATTTTtAGCAAATGAGTtGTAGTTGCCTTCATGAAAGCTGTTGAGAACGCGTACAAGAGACAGCTGGGATACGTCCAGATTCcGGAACCGAGATGA
TATGCcACCTTTAaCAaGGCTATTGGACAGCAGTGATGTTtGGCGTTCGGTGTTCAGtAGTTCAGAAACGAGATCCcACCGAGATAAGCGCCACGCACAC
TCAAGAGCGTGGGGgTAGAGAGTTCCCACATGCTGAGGCTCTTGAGTTACAATGCCGTTTATATGTTGGAGGGCACTCTCTAGCCGACCGAGTTGAATCA
AACACCGTACTATACCTGAATATAAAGCTGGCTTGATAGATCGTGGGTCTTTTGcatcccccAAATCAACCAGTTTCTCTTCATGAGACTCCCCATCGCC
ATCCGGTAGACTACCGTAAAATCCGAACGAGGCGTGTGCAGAATGCACCTCTTGTATCGCTTGCTCATAGCATGCCAATGCGTCTTCCCACTGAGCAAGC
TGCTCGTGATCAACAACCTGATGAAGAAGATCAACTAAACTGGAcTCCTCCTCTTCAAGGGCAGGCCCACTTGGGCTTTGAGCCATATGCAACCGACGAA
GAGTGGCGAGACCCGTCAAGGCGTCAGGCTCTTCAACTTTGCTATATAGCTGCTGAAGATAAGTTGCGTGTTTTGAGATGAGTTTCAAGTCAACTGGAAG
CATAGTAAGCAGGCCACTTGTTTGTGCAGATTCTGTAGTCTGAGGcGGTTGCTGCTGTCGTAAGTATACCTCAAAATATTGCAGAGCTCGAGCGAATGCT
TTTATACGAAAGGCTGCACTTGATAGAGCTTGACTAGGTATATCTTTCAAAAACTCCTCCAAATTTTCCTTCTCTTGGTCATCCAGTTCCGATGGTATTT
CACCAGATTTGTTTtGGgTTTGCGCTGTTGAGCCTCTCCCCGCACTCAAGGCTAACCTTTtCTTTtCACTGTtCCAaaCCCACTCGTTCAGCTCATCGAT
TGTAGCCATAATTGTTtGTGCACACTGATGATGTCGACTAGCGTATTCACCAAAAGCCTTTTCCTGGCCATCTTCGGAACGTGACGAAGTACGAGAACCA
GTTAACCCTGCCCGATCATCCATGACTCCGTTGTCACTCAAAaCTGCCATGATTTCtCGTTTGACCTCTTCGTAGACTTCCGGTCTTCCTGAGCATAATA
CGTTTTGGAGCAGGTATGGAAGTAAGAAgcGTCCAATTTGTGCACTTGTGCTCACAACCATTTGGCATGCCTGGAAAATCTTCCGCTCAGGTGGTTTTGA
GAGTTCAATCAACCGGCGGCACCACCCGTAAAGCCATTCTTCATAGgTCGACGAGTATTTCTCATAGAATGTCAaTTCAGAACCCATTCTAACCTTCTTC
TTGTTGTCAATTGAATAGTTGGTATACCAGTACGGTTCCACATATTCAAGCACGTCCTTCCGTTCAAAACGTCTCTTCATCCACTCCGGCATCGGTGGCC
CGGTTTTGCGTTTCGCGCGACGATCCGGGTTGTTTAGGCCGCTGTTGATGGATTGTCCACTGTGCTGAGGATCTTCCGTTAGCTCAGCCAGAAATTTCAA
TAACTCCTGGATTGAGAAGGCGACTTCGTCGGTGTTCTCTGGAGCAGCGCGGAGCTCCTTGACGAGCCAGTTTTCGATCAAAACACAAGCAAGATCCTTC
GTTGAGTATTCGAGACGAGTCTCAGGTCTATCCCGAAGTAGATTTGAACTTGTCGTTGTTGAGCGCAAAATGTTCGATGGAATCCGTGCTCCGTCAATAG
CGCCCAATGCACCCAGACATTTTGCACACTGAGATCGAACCGATTCAGTGgTATCTGTTCGTGCAACACTGAGGAGGgCAAaCAATATGTCTAGAACAGT
GGgATGAATGTAATCATCCTCAGAaTGCAGAAGtAAGCGTAaCTcGTCAGCTCGTGACACAAGAGTTTGATGAATATCACTCAATACGATCTCCCGAACC
GCAAGATCCCAGTGAGAAACGTATGGAAGACAATTGATCAGATAATCAGCCAGGgATGCTCTTGCAGGATcTCCAATCTCAGCGATAtATGATGCATGGA
TTTCGTCGAGCGCAGGTATGTtCGGAaTCAGCCGTacccGGGGAAATGCGTGCTTCAAATCGTGTAGACGATCAACGAAGAGATATTTGAGAATTGCAaT
GGCCGTCAGCATTCCTGAGCTGTAGGCTGTGCATTCGACGTGGTCGTTACTTCCATCTTTCAGTTGTTCCGCGTAtCcGTGCTTCATAGCGATATCctCG
CTGGGATTGTCAATGCATGGTAATACACTGACAACTAGaGACACAAAGTTCGACTCCAATGCTTTAGTTGTCAACATTCTGATGAAGATCCCCcATGCAT
GTACAGCATCATCTTGAAGTGCTTtGTCATGGAGGCCtACTTTCAGAATAGCCATGACTTTtGGTaCAAAGGGgTCGAATGCACCTTTCAAGTCATCTAC
ACCCCcATCGTCTTTGCGATGAAAGACGCGGAACAAGCAACCAATGCTTCGAATAGCTCTGATACGATTTTCTCGCCGTGGTTCATCCTTGATTTTGTTA
CCGAGATCGGTCATTAGAGCAAGAAAATAATGACGTGGCATTGTGAGCGATGAGCCTTTGTCGCGTTGTACCTGATCAGTGTCTTGGTTTagATAGCTGG
AAATCTCTCGAAATGCCCGCTTCGCGAGACTAGACTTTTCCCCGCCCAATTCCCAAACCAGCAACTTGAGGAGACGCAGGGAAGCATGATCGATAGCATC
TCGTAGAGTGGTATTCTGTTCGAGCCgATTGAGCAAAAAGTGCCATTCCTCCGTTCGTTTGGTGTTGTCTTCCACCTGTACTTGATGGAGTACAAGTTCC
TTCAATACGTATGCAATGTTTTCGTTCAGTAATTGTTTCAaaGTCTTCGTCGGAAGACGGGAAGGTTCTGATGACTCCTCAaTCATTACCACGTCGTCGC
cGACAAtAACTCCATTATATGCTTCCAAGAACGTTTCCAGCATATCACTCTGTTGGTCGATAAtATAACGTGGAACAACCCATGGTGCACTGTCTTCTAG
TAAGATCGCTTCGTCAAAACTTGGGCCGAAAAAGACAGCAACGAAGCGTTtAAGACTGTCAGTCCGCAGCAGAGCATCGACAACAAAAAAaTACAACTCG
GATGGGTAATCCGCTAAAAGTCGCGGCCAGGAAaTTTTGtGGCTctCAAAAATTCGACCTATTTGATCGAACGCAGCAGTTGCCACAGGTCTCAATGCGG
ACTGGGTCTTTATCCACAACGTGAGAAGCTTAAGAATGCCCCAAACAaCGAACTCGCGCTCTCCGCAATGTTCTAAATTCACTGCACAGCAaCAAACtCC
CAGAGCTTCGAGCGTTG