Description :
From Genome Similarity Track
Location :
Scaffold_6:718469- 720181
Sequence
1712 bases(100 bases per row)
GAAGCGTCTGCTGCGCATGATGCGGGCCCGGGTGGTACACGACCTCCATGCCATGGTGGTGGTTTGGCATGCCGAGCGTGCCCATGGCCATGGCCGACAT
CATTTCTTGGTCGTCGTCCAAGCACGACGCGATCGCCGCCGTCTCGTTGCTCGGGCTCTTCTTCTTCCGGGGTTTCTTAACCGCTTTGGTTTTCACCTCG
GCCAGCACGGGCAGCAGCGTCTCGTCCTTTGCAAGGTCGTTCTCGAGCGGGATCTCAATCCGCATCTTGTGGAACACCATGGCGTACGTACTCGCCTTGT
AGATCGGGTCGAACGCGTTGACGACGAGGCCCTCGCGGCCAAAGTGGCGCGCGGCCGCGATAAAGTGCCGGCACGGAATGCCCACTTGGAGCATGAGCCC
GCACGAGCACGAGAGGTCCGAGAGGTGCACGCGGTGCGTCACTTTGGGGCGCGACCCCGTCTTCCACACGAACGCCAACGTCTCGTCGCACGGCCGCGTC
GTGAAGCCAAGGGCTTCGTGCATCTCGCACGCATACAGCTCTTGCGCGCCGGGCGTCAAGACTGCGTTCTCGGTCGCGAGCTTGGCGGCGGTCTGGCTCT
TTTGGAAGACGTTGTCCATGAGGCGCGCGAGGTAGCTGTAGAGGATATCGAACGGCGCCTCGTCGACGCTTTCGCTGCTTGGACCGTGGAGCTCCGAGTT
GAACGACGTGGTCGACCACTGGTAGAGTTTTGTGTGGCGGTTTGCGTGCATCGCCCAATGCAGCGGGTTCTGGCTCCGCAAGAAGAGTGCAGCCGCGGGG
TTGACGCTCTCGAGCTGCGAGAGCGCGGCCTGGAAACCTTGCTCGGTCTCTTGCCGATGCAAATCCCAAATCAGGAGCTCGACGGCGCCGAGCTTGGCGA
TGTGCTTGTCGTTGCCCATGCACTCGAAGAGGCTGCTCATGCAGTACTGGACCTTGGCGCCCGTCGCTTCGATCGCGTCGGCAATCCCTGCGTGTGTGAT
GGGCACAAAGATCGGCAAGTGCGCCAGCGAAATGCCTTGCTGAATCCGCTGCAGAAACCACGATGCGTGCTCGAGAGTCGGCGCCGGGACAAGCCCGACC
GCGAGCACGTGCGACTGGAGGTTCCCGTCGCGGCCAAGCAAAAGCAGCATCGCGCCGCTGTACTCGGGCCGACAGAAGGGCACGACGTCGATCCCGAGGA
TGCGCTGGAGCGCCGGCATGGCCTGCAGCGACGCGTGCGGCATGACAAACGCGCGGACAAAGTGGTGGTCACCGTCGCGGTCGTAGTCGGCGATCGAGCC
CGGGTTCTTGGCGACAAACATGGTCAAGAGCGAGGGCAGGAACTTGTACGACTCGACCACATCGTCTTTCGAGTGCACGACGATCATCTGCTTGGCGCGG
TACGCTAGCCGCAGCGGGATCTTGATGCCATCTTCGGTCGACGAGAGGAACTCGTCGGTGAGGAGTTTCCCGTGCTGCTTGCCGTGGGTCACGACGGCTT
GGCGGAACGACGCCATCTCGGCGAGCTGCCGCGCCGACGGCTGCGCGACGCCCGTGCACGCCGGCGCGTGCGTGAGGTTCATGGACGAGATCTTCCAGCT
CTCGGTCTTGGGCGCTTTGAGGAGGCGCACGTACCAGTCGCAGGCCTCGGACGAGCAGACGTACTTTTTGTTGCGCCCGCCGCTGGTCTTCTTGTCCATG
CGCGCCCGCTTC