Description :
From Genome Similarity Track
Location :
Scaffold_39:71845- 75910
Transcript NameFunction/comments
Physo_135534hypothetical protein
Physo_135535hypothetical protein

Sequence
4065 bases(100 bases per row)
CCTCTCCTCGTCCCTTATCGGACTGAGCTGATGGTCATCGCATAAGCTCCCATTAATGAAACTTCGTTTGCCCCCAATGTAGTGGAATCGATTATTACTG
TATAACGATGGGCTCGATGACGAGACCAATCTGTAAAGATGCCCACTCCGCAAGTGCAGCGTAATCTAGGATAGCGTTGGCACCACCGGAGGACGACAAC
AGCTCAACCGGCAAGCTCGGCGCCACAAGTTACTTATGACATGCTACATACACAAGTGTACATGTAGCACACACAAGCTTCTAGGCTGCTCCATGTTTCA
GCGGTTTATAAATCCACCCAATCTCCTCTCTTTCTCTCTCAATCTCCTTGGTGCGGCACCAAGTCGTGCCAGTCCGGTAGCTGCCACTTGTTGAAGCGGT
CGAGGTCCTCTTTGTCGAACATGCCGTTGATGGCGATGCCCAGCAGCTTGCCGACCTCCTCGTTGCCCTTCTGCGAGAAGTGCAGCCCGTCGACGAAGTA
CGTCTTGCGGACACTCTCATCGGGGAACGTCGTGTTGAAGTACGTATGCAGGTCCAGCACGTGCACGTTCTCGGCCTTGGCCAGCTCGACGCACGTCTTG
GCGTACGAGGCGGCCGACGCGTTGCTGCGGTCCCCGTGGCGCGCCGAGTCGATGACGCAGGGCGGTGTGATGAGTAGCACCTGGCCATGCGGGGCCAGCA
GCGGCCGCACCGTGTGCAGGATGCGCTGCAGATTGGCGCGGTAGTCCTGCAGCGACACGAACTGCGCCTTGTCGGGCCCGTGCTCCAGCACGGCGTCGTT
GGCGCCCAGGAAGACGGCCACGAAGGACGCCATGTACTCGGTCTGCAGCTCCTTCTCGTAGATAGGCATGGCATGCTGTAGCACCCACCTGAAAAGGGAA
ATAAATAAACGGTAAAGTATTAGTGAAGTATTAGCAGCGATGAAGTGCAGGACCTACTTGGAGTTGTAGCCCGAGAGGCCGCGGTTGACGCAGTCCACGG
AGCGCACGAAGTGGTTCTGCACGATCGTGATGAAGCCGTGCTTGCCCGGGTCGCTGCCGTGCTCCGTGATGGAGTCGCCGATGAAGTAGAAGACCGGGCG
GCGCTCGGCCGACAGCGTGAGGCCCATGGCGGCGTTGAGATCTTCTCGCAACTGATTCCCAGGGGGCACTTCAAGCAGGATCGGCCGTTGGTCCACACAA
TCTATTGTGCCTTTCACGTATTTTGGCGGGTGAGCTGTTAATTCAGGCGGAATTAGAGTCATAAAAGGGCGATTAACGCTTATTTAGTGCTAATTCTGCC
TAAGATTGTGAGCGCTTCCCCTAACACCCGCGATCAGCATTTGAGAGCCAATCGGCGGAGATATTAATACGAGCAGAATGGCATGGATTGGCGGGTACAT
GTAGGAAGCCGCCAATCGCTCTGTTTTCGCCTAACGCAGGCTGGATTAGCTTATTCCACCTTAACTCGGCCTCACCATCGCCGCTCCCAATTCGACCACG
GAGGGACGACCCGGAATTAAGATGGGAATTAGCTGGCATCTGTTGCCGTATTCCGTACAAGAGGTTCAACATGCGTTGTGACAGGACTGAATCTTTGAAC
GCTGGCGTCAGTCCGTGCTCCGTCCCGGAATAGTGGTGAAAACCCATCAACCATCCGACCCGCCTGAATTTTTTATCGTACACTCGCGCCATTTTCTGTT
CGATAAAAAATTTCTTTGGAAAAATCAGCTTTTGTTTTCAAAAGTTTGGTTTAGATTGCACATAGCGATTTGGAACGGAGCGCTGTAAGTTGAAGTGCTC
CGTTCCCTTTCGCCCCTCTCGCCTTGTGGGTATCGACAACTGCATTGATGGAGGCGCGCCACAAAAGAAGATGCCGTCTAAAGGAAAAGCGCGCGCGAGC
ACGGCGACGACCAAGGAGGTGGAGGAGGAGCAGGAAGAGAAGGTCGGTCATGTGGGGCGCCGGCCCCACATGACCGACGAGGACGTCCAAGGCGTGCTGG
TCGCTGCCCAGGTCTTCGTGTATCCACCTGACGGCAAGAAGAAGGAGACGGCCGGCCAGATCGACGTCCCCAACATTGCAGATCTCTACGATCGCTGCTC
CGCTACTATCCGAAAGATTATCGACCGGAAGCCAAGGATCGGCAGCGGTCGAGTGCCCATTCACGACCCTGCCGTCCTGGCGCAGCGATTGCGCTCGCTG
CCGCCGAACTTGAGCGCGAGGCAAAAGGCAAGGCGCGCGGGCGTGGCACCAAGCACACTAGCACGGCTGCGCGATTCCATCGAGCAGAAGCTCGCTGAGG
CGACTACGGTCCGTTTCGAGGCTGCCAACCGGAGCGTGCGGATTGAGATGTTGCAGCAGCTTTGTCGTGACGACGTGACAGAGGTGTGGATGGCGTATTA
CGCTGTCACCGACTGTGGATTCGTAGATGTGTGGCTCGTCGGGAAGGGCGTGAAGGTTTACGTGTTGTTTGACAAGATGTGGACCCTTACCTGCAAGGCT
GCCGTCCGGTGTGTGAAGCGGTTTATTCTTGCAGGCATCGAGTGTCGGTACCGGCTGTGCATGCTGCACTACAAGCTCACGGCAATCATTACAAGGACTG
CAGTAATTACTTGGTCTGGATCGGCTAACCTGACAATCGCGGCGTGGATCCACAGCGACGAGCTTTTGGTCTGCACAGAGGGACCTTGTGGTAAGTTTTC
GTTTTCGTTTGTAGCACTTTCAATCGCAACATTTCTGTTTTGCTAACTTGTTGTACTTTTCACATTTATAGAGTACGAGGCATACAAGTTGTTGTACTGG
CTGTGGTCGAGAGGCATCACTGCAACATTGGACGACTTGGCCAATTTGGTCGCCCGAAATCCGGTCGGCAGTGAAGCTGGAGACATCACCATCGTCGTGT
CGGACAAGGAGCTCAAGTTCGTCGAGGGGGAGGCTGGGAAGCTGGGACTGCAGGAGTGGGTCGACGGCTGCTCTAACTACAGACGGATGACTCGTTACTT
GGACCAGTGCGCGCAGGAACGCGAGCTCGCTATGCTCTGCGGTCAGAACGCAGTAGTTCTAGCGGCAGAGCGGCCTCCCATACGGGATCTGGACGCCCAC
GGCCTCCCAATGCCTGAACCACAGAGTCCACCCGCCCCCGAAGCCCCTGGCCCCTTCCAAGCTCTACAGACTACAGCGGCCACCCTAGAACGAACACTGG
GCAAATTAAAGCAATGGTCGCCAATCTATCGCTTCTGGAGTGTACAAGACGAGGTAGACCAGCTACAACAAGATGTGCAAGACGCGGTCGATGCGAGACT
GCATGGCGTCTCCACTCCCCAACGAGTCCTCTTGGACGAAAAGTTACGCGTTGCAGAAGCCCGAAGGCAGAACAAAGAGCTTCGGATCAAGCGAGAGAGA
AGAGAGCATGCCATACTCCGATACCTCAAAGTCAGGAAGGCATTGGATTTTGCTGAAGAAGAGCTTGACGAAGTGGCCCTGGAGGAGACAACAGCTCAGA
CACGCGCAACGGCAGGGTCAAGCGCAAGAGGGCGAAGGCAGAGTGAGCAAAAGGAAACAAGTTATGTATTTGTGCATTTACACTACTTGGCTACTCCTGT
CTTCCTTATCGGTGGCGGGTGCGGCAAGAATCGAGCGGCAAGGTCCTCGAGGAAGCGCGCACACCGATTCGACCGGACCTGGATCGTAACAGGGTTATGA
GCCCAAGACCCATCCGGGTCTAAACGCGTGTCTGGCTGCAAGTGTTGCAACTGCGGATTGAAGACTCCGACCACTGCCGGATCAGCTGGAAGCTGGTGGC
CGAGTGGGGTAGCGCGCTGTCCGATCAGCGGGAGCTGGCGACCGAGCGCGTGTGTGCCGCTGTCCGATCAGCCGTTGGCTGGTGACCGAGCGGAGCAGCT
GTCCGATCAGCGTGTAGCTGGTGACTGAGTGCGACTCCAACTCACTGTCCGATCAGCCGCTGGCTGGAGACCGAGTGCTGTTGGAGAGGAGAAGGACGTG
CTGGACTTCACGACGGGCAAGAAGGTGCTCGGGAGTGCGAAGGACCAGGCGGAGTTTGGCGGAAA