Description :
From Genome Similarity Track
Location :
Scaffold_5:718214- 720855
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002408Protein of unknown function
Pytul_DAOMBR144PYU1_G002407Similar to Ttbk2: Tau-tubulin kinase 2 (Mus musculus)

Sequence
2641 bases(100 bases per row)
TCTGCTGCGCCGGGTGCTTACTTTGACTCCCATCTCGAAGGCCGACGAGAACCATCGCGCGGTTTGCTCGATTGCTGGGAGTTATCGTGATGGCGGTGGT
CTCGGCTGTGACCACGATACTTGTCATCACGGGAACCAAACGAGCGGTGGTGATCCTTTGATCTAGAGCGATAACGAGAATCGGAGGATCGGCGGCGTGG
AGAGCGGGATCTCGACTGGGAAGACGATCTCGATCGCGTGCGACGGTGTCGACTGCGGCCGCGTTTTCCTGAATGGATCGGTGAACGAGATCGGGAGCTA
GAGCGAGAGCGAGAATGTGACTTGGAACGGGATCGAGACCGCGAGGACGAGCGAGAGTACGAACGATTGCTTGGTCGACGCTTACGATCCCGTGATGATG
AGCGTCGCTCATAACGCGTTTTATCCCTCCGGCTCGAGTCATGATCACGATCGCGCTCGTCACGCGAAGAGGAACCCGAAACCTGTTCACGCCTGTTGCT
ACCATTTTGATCGCTGGCTCCGGATGATCGGCGCTCCAGCTCTGGCTTCGCAGAAGGCCAACTGTTTCCCTTTGGCATCGACGGTGCTGGAGGTAGAGGG
GGAACAAAACCTGCTCCTGGCGGTAAATATCCTGGCGGAAGAGGCAGTGGAGGCTGGCCCATGTACGCGCCATTTTGTGGCGGTCCAGGAGGAAGCGGTA
GACGCGGCGACGAGGAGAACGGCGGTTTGCTACCATTGTTGTTCCAGCGCTGTGGGGGAGGGCCAGGTGGAGTGGGAGGTTGCAGAGGTTGCGGAACAGG
GATAGGTTTCACATTTCCGCTCATATTCCCGTGCTTTTGAGCGTACGAAGGCGTCCCAGTCTCTTCACCATCAGACACCTCCATGGCACTATCCTCTGAC
TTGTGGTCGATCACTTTTACATCGACTTTCACGGGAGTCCCGCTGGAGCCTTTACCATCGTTCGTTGGCAACGCAGCTGGTGCAGTATTCTGACGCCGAG
TTTTTAGTTCTAGCGATTGGCGAACCTGGAAATCCCGCTCTCGTCGTCGACGTAGCGCGTCACTGCGTAGTTTTTGCTCTGAGAGACGGCGCTTGACAAA
ACTCTGAATCGGAGGCGGGGCAAGCACCTGGGATAAATCACGAAGTTTCTTCTCTATCCGATACACGGCTTCCTGAACCTCGACTCGCTCTTCACCTGTC
AAATCCAAAACGCCAAAGAAAGTGTTGAACTTCTTCGCCACCTGAAACATCACAAAAAAGTATTTTGTCAGCAAAATAAAATCCAACCGTGCTGCAACCC
ATGATCTCAATTTGCCACCTACCGCTAAAAGCGTATCGAGGACGGATTGAGGCGTATTGTCCTTCACCACGGCATCTTTTGCTCGCATTGTCCACTGCAG
CGCACGCTCGCGTTCGGATTCGATTGCGTTCCATAGCTCCATCGTGTCCTCTTCTTTCGACCCGGTTTCCACACGCTTCAGCTTTCGCCGCAAGAAATCG
TAATCTGGTTTATCCTCGTATTTCAGCGATTGCAGGTATTTCATCATCGCGACCAGGTGACTCGCACCAACAAGTCCTTCCACCAGCAAGGACGGGCATT
TCTCCGTGTAGTACTCTTTCAAGTTCAACACAGTTTGGCGGTTCTTTTGCTGCGCATCGGTCGCCCATGGTAGCTCTCCACGCATGAAATCCATCACCAA
GTAGAACCACGACCACAAATCGTCTTTCGGACCAAGTTCTTGGCGGCGATGGGAGCTCAACGACGCATACATGGATGTGCCACGGAACTCAGCCTGGGGT
CGAGCCGGGATCACTTTCTTGTCCTCGCCAAGGTGCTGGCGCGACAACCCGAAGTCGATAATATAATATTTCCTGCCAAATGTAGTCACCAGCAGCAAAA
TGCTCATTAGAAAAAAACAACGAACACACGAGTCGCTCTGGTTTTGTATGGCATATGGCTAGAGCACATACCCCTTTGCTGGACTGCCTGCGTCTGCCAT
CGCAAAGTTGGACGCCTTGATGTCTCGGTGCACATACCCATGCTGGTGGAAAGCTTGAATACAGTCCAGCATCTAGTAATGTAATGTATTACAACAGCAA
ATATTAGACACGATTCATTAATAAGCTTGCATCATGATGATGCATAAATCATACCTCGAGGCCAACAGAGACACAGCGCTGCAGTGGGACGCCGTGAATC
GCGTCGGGCGTGACGCGCAGCATCGACATGCTTTCGCCGAGCAGTTCCATGACGAGCACCGTGCTCTCAGCGTGCTTCCCATGGTAAAAGTACCGACACA
CGTGGTTGCAGTCCTGAAGGCTTTTCAGGATCGAGCTTTCCCACTCGAGCACAGGCTTCAGCGAGCTCGGCGCCTCCACCTTGACAGCCACGCGCTGGTT
CTCGTGGATCGAGTACGCGAGGTAGATCTGGCTGAACGTGCCTTCGCCGATCTTCTCGACGATCTTCCAGCGTTCGGCGATCACTTCGCCAGCCTAAACA
TAATTCCATAATAAATGCGCACCGAGCCAAACAAAAAGCAAACAACAGCATTTAAATGTCATATTGCCACACCCGAACCAAACGCAGCGGCAGGAGAGCG
TACCAGCAGGATGTTTTTGTTCAGCGCCTCCATCGGTCGTC