Description :
From Genome Similarity Track
Location :
Scaffold_1271:7182- 8882
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh-par_contig_1271-abinit-gene-0.17Reverse transcriptase

Sequence
1700 bases(100 bases per row)
GACTCAGCTTGGACAGCGCTTCAACACGAAGAACCTGAAGGCCTGGCGTTCGGCACTCGATGTCACCGCGTAACTGCTGAATCACGATTTAGGAGTCCCC
GCAGATGATGACATCCTTCACACCTCGTCGAATCGCCAGATCCATCGCGGCCATTGCTCCCCTGTACTCGGCTTCGTTCACGGTACCATCTTCGAAGTAG
AAAGTCTCGGCAGCTGTAATCTCCCATGTCGGCGCCGACCACAGTATCGCACCGCAGCTTGCGCCAGCTCGCTTCGGCTTGGCCGACCCATCGAATGAGA
CGATCCAGGCGGAGGCGCCGGGCGCCACCGTCGGCACCGGGAGCCGGAAGCGCTCTTCACTCGGCCTCTTCCTCAGCTGTATCGCCTCCAGCATCTCGTC
GGTCCGATCGGCTGGGCCAATTGCCGCTGCCATCAGCCCTGTCAGTCCGTCTTCACCTTTCTCGATCCGCACGACTTCAAGAGTCCATGGACTCAGCGTC
ACCACCCAGCGTTCGAGCCGACCCTGCAGCCCCTTCGCCTTGAACAGCCAACTGAGCGACGAGTGACGAGTGAACACCTTGAGCGCCTTCCCGATCAGCA
TGTTGGCTGCTGCTGAGAGAACATGCAGCAACGCGAGGATCTCCTTCTCGGCTGGTGTAAACTTGATCTCGTGTACTTTCAGCACCCTGCTAAAGAACTT
GACCGGCATCCACTTCCCATCGTGTTCCTGAACGAGAGTAGCCGCGATCGCCGGCGAGTTCACATAGATCACCACCACTGGCGCCTTCTTGTCGTCGAAG
TGTTTCAGTACCGGCGCATCGGCAATTTCTGCTGCAGCTCGGCGAAGGCACGACGAGCCGAAGCGAGATGGCCGGGTTCCAATACTTCTTTCGCCATATC
AGCCTGCGTTGCCTCATAGAGTGCAGCCACGTAAACTGCGAAGTGTTCCACGAACTGGTGATAATAGTTCAACGATCCGAGAAACGACTGGATCCCTTTC
ACAGTTCTCTGGAACGGGGGTTTGACCAGCTCGTCAAGGTTCTTCGGCTTGGCCCTGATACCTTTGGCCGAGACGGTATGACCGAGATAGTCCACTCGGC
TCATGCCGAACTCGCTCTTCGGCAAGCTGATCGACAGCCCCCATTCTTCACATGCTTGGAGCAGTCGTTCAAGTCGCTCGCACATCTCGTCCCAAGTACT
CCCGCCGAACAAGATATCGTCGATGTAAGACCGACGCCAGATCGCTGGCTGCGTCTCGGCTCCAGCCGGTTTGCCGTCCAGGAATACGTCGGCCTCGCCC
TCTTGCAGGTGCTTGGGAGTCAACTTGAGGTAGCCATAGAGTGCATTGTCGAGAAGACGTTGATAGATTTGCGGCGCATTGCGTAAGCCGAATGGCATTC
TCAGCCACTCGAACAAGCCGAATGTTGTAACGAAGGCTGAAATCGCCCGGGCTCTCGCCGTCATCTTCACAACCCAGAAGCCGGACGCCATATCCAACGA
GCATAACCACCTCAGGTGGCCGAGATTCTCAAGTAAGTCGTGAATGATCGGCATCGGATACACCATGAGCCGAGTGAGCGCATTCACCATGCGATAGTCA
ATGCAGAGGCGAATGTCGACACCATTTTTCTTGATCACGATCACGATCGGCGAGGCCCNNNNNNNNNNNNNNNCCGACACGACTCTGCGATCGGCTTCGC