Description :
From Genome Similarity Track
Location :
Scaffold_736:7182- 8492
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_736-fgenesh-gene-0.2GH11862

Sequence
1310 bases(100 bases per row)
CACAATGCAGCGCGGTGTGAGCCGCGGCTCTGGGTCCGGCGAGGAGGAGGACGATGCGGAGCTCGCGTCGCTCATGCGCGAGGGCTCGCGGCGCGCGGCG
ACGCTGGAGACCAACGCCGCGCACGCGCCGTCGCCTCCCCGCGCGCGCTGGCGGCTCTTCCTCGGTGCGCTGGTGTTGCTGAGCCAGGTGCTGATGGAGG
TGGCTCGCCGCGCGCTTGCCTGGGTCGAGCGGCACGGCCCGCGGTACGTGGCGCTGCTGGACCGCTGCCTCGTGCACGTGCTGCGCGTGACGGTGCGTCC
GCGGAAACCCGTCGGGATGCTGCGCGTGCTGCTGGCGCTGTGCCTGGTGCTGGCTGTGCCGTACCTGGTCGTGACCATGCGGCGCCTCGGCTTCCCGACC
GGCTCGGGCCTCACCCTCCAGTACGAACCTGCGTGACGATGGTGGAGCGGGTGGGATGGACGGAACCACTGACGCTGTGTGGGCTGGTGGTCGTTGGAAC
AGCGCACAGGAGCTGACGGAGGACATGATCCGGCCGCACATCATCGTTGAGCGTGCCGGTCCGCCGACTGCCACGAGACGTCAGACATTGTTGCGTGAGG
GCGGCGACGGTCTCCAGCCGGACGACACGGCCGAGAGCTGCGAGAACACTGTACAAGGCGCACACATGATCACCGACTCGATGGGTGCGTGCTGTATTAT
GTCTGGTGGTGGTTGTTTGCTAGAATGAATGATGCTGAAGTATAATTATGTGGCGACCTGCAGGCTACGTGTGCTCAAGGACGCAGCTGGACCGAGACAA
GCCCGGCTGCTGCAACGAGACGGACGCGAGCCTGCCACGCATCAAGCAGTTCACGTGCGACCGGTGCGACACGAGCGCGCCGCACTGCTGCGACGTCTAC
GAGCACTGCGTCTCGTGCTGCATGCACCCGCTCAACGTGCGCGCAGCTTCCTCCCTGACGGATGCATTGCGCTGGCAGTGAAGAGGCTCACGACCCATTG
AGTTGCCATGCTACAGACCAACACGCGGCGCGAGTTCCTGACGCACGCGGAGCCGGCGCACCCGATCTACGGCGACCCGAGCTCGCTGACCGTGTTCCAG
TACTGCCGCGCGCGCTGCCGGTCGTCGTCCGCCAGCGTGCAGCACCAGAACTCGTACCGCAGGTGCGTCGTCATTAGATCCGCATCCATTGCAGGGGACA
AGTGGCATGCTAACCATTGCCCGACCCTCTGCCGGCGGTGCACAGCCGCCGCATGCACTGCTACGGCATCCATCGGCCGCTCAAGGTGCTGCCGACCGTC
AACAGCGACG