Description :
From Genome Similarity Track
Location :
Scaffold_839:718- 3222
Sequence
2504 bases(100 bases per row)
AGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACT
TGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCAT
TGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCAATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTA
GCCAATTACTTGCACAAGTACAGTGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGC
ACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTTCTCCAGGCTCCGATCCTTGCGCTGCCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTC
CGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAGGGCGTGAACGCGTGATCGCGTTGAGTCTCGCCAGCTCAAAGCTGCGGAGAGAACTAT
CCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATG
CGTCGTTACGCACTGCGGACACAGGCACCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGC
CGGGGCGGCTTAATGTAGTGGCCGATACGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACG
CGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACAGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTCTGGGCGCTTACGC
GCGAGGCTGCATCGATACTCACTCGATGGCGGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCTTCGTGTGGTCGTTCCTCATGATGAGGATCTAA
AGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAA
GATGTATAAGTGGGTCGGCACCTATTTACGCACGTGTGAGACGTGTCAACAGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTC
CCCAAGAGATGTTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGACAAGACAGGAAACACGGGCATTGTGGTCTTTGTAAACCGATTGA
GCAAGATGGCTCATCTAGCGGCGGTGCCGGACACCATAGATGGTGAAGGTACAGCTTTGCTGATTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGA
GGCAATTGTCTCGGCTCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACAGAGGACCAT
CCACAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTTGAGGATATCCTCCGAAGCGTATGTGCTGAGGCGCCAAAACGCTGGGGCCAGATGCTCG
CACTCGTTGAGCTCGCATTAAATAATGCAGTGCACTCCTCGACAGGCTACACTCCGCTCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCC
GCCACGCAGTGGCTCAGGGCTTGATGGGGAAGAGATAGCCGAGCGGCTAGCTGATGTCAGCCATGTTGCGGCTCGCAAGCAAGTCAATGACTTTGTCTCT
TTGAGACTAAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACATGCAAAAAGAACATGCAGATGCCAAAGGCAGACGCAATGAAGAAA
GGTTTGAGGTCGGAGATCAAGTTTTATTAAATGCAAAAAACCTACCTACTCATGCAGTGTCTGCGGTCTTTAAGACAAAATTGAGACCACGGTTCATAGG
ACCGTTCAAGGTCGTGGCCAAAAAGGGCCTAGCGTATACGCTTAACCTTCCGAAGAAGATGCGCACGCATCCAGTCTTCTACGTTGGCTTACTCAAGCCG
TATCAGGACCCTGCTCAGGTGAGCGCGGAGGCGTTGGCGCCAACGGTGGCTGGGCCACGACAGGCTGCTCATCTTGCATCGCAAGTTCCAGAGGCGGTCA
CAGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCCAAGAGAAGATGAGCGCCGCAACGGCGGCGGCGTCGATGACGCGTGA
AGAGTCTATGAGTCTGAAACCGCTCATGGTGAGCGTAAAATGCTTCGAAGGGAAGGATGGAGAGAATCTCCTTCTCTGGACTCGTGAGGTCGAGATGGCC
ATGG