Description :
From Genome Similarity Track
Location :
Scaffold_138:71795- 72911
Transcript NameFunction/comments
g18587.t1hypothetical protein

Sequence
1116 bases(100 bases per row)
GGGCAAATCCATCTTTGTCAGCTGCATGGCCCGTTCAATAGCGGACGGGTCGGTAACACCCGAGATGATTTCCACAGCAGTGCCGATCATCTTGCGGATG
TGGTGCAGCAAGAAACTTTGGCCAACAACACGCAGTCGCACCCATTCCATGCCACTTTGCACGAATGGGGGATCAGCCTCAAACGAAATGATAAAGCGTT
TCGCCTGAGGGTTCGAGGGCTCCATCTTGGACGTAAAGTTGTGGAAGTTGTGCGTGCCAACGTACTGCTGCAACGCGGTGTTGAGCTGCTCCAGCGTTTC
ATCCTTCAGTCGGAACGCCTTGTGCGCTTCCAGCGTCGTGTTGTCAATCACCATATTGTCGTCAAAACCCTCTTCAGATTCATGCAGGTCCGAAGGCCAC
GAAGCAGTCGCTCCGTTTGCATTTTCTTCCTTCTTCTCCTTTGGCGTAGCATGGGCACGCTTGGCAAAGATGAAGGTCGGAGCGAGGTACTCGTAAGTCC
GCTGGTCGCAGGTCATTTTTGCGTTGAAGTTCTTGGTGACCGAGACCATCTGCATCACTCGAATGTCTTCGGGCAGCGCAGCATTCACCTTGTCCACGAA
GCCCTCGACGTCGTCGCCCACGTGCAGCTTGGCCGTGAGCAGTTGGCCTGCAGCATGTACGCCCTTGTCCGTCCGAGCCGCGCGACTCCATCCGATCTGC
AGCAGCAAAAAATACAAGACACTACTGTAAATATCACAAAAGCTCCCAGCTCCAGCACTAGCCAGACGGACCTTCTGCAGAAACCCGTAGTTGGACTCGG
CGATGCCCCCAGCCTCGAACAGCGCGCGCTCCAGCTCCGCCTCAATGGTCTTGACGCCCTCATTCATCTGCATGCCGCTGTAGTCCTTGCCGCAGAAGGC
CACCCACAGGCCGTAGCGGCGCTTGGTCGGCTTCGCTGCAGTCTCCGCAGTCTTCGCAGTCTCCGCAGTTGTCGACAGCTGGCGCTGCGCCGCGTAGGAG
CCAGGGTGGACGGCTTCGGAGCGGTCGGCACGGCGGTCGGGACGCGGCTCCGTGTCCTGCTGCTCGCCGTCGTCCTCGCGCCGCGCCTGCTTCGTCTTGC
GGCGCGCGGCCCAGTG