Description :
From Genome Similarity Track
Location :
Scaffold_2:717869- 719224
Transcript NameFunction/comments
Physo_127585hypothetical protein
Physo_127586hypothetical protein

Sequence
1355 bases(100 bases per row)
TCCGTGCGTCCCTCCTCAGCGGCCCTGATCAGCGCTGTGTACTCGCGGTTGTCCTCAGCATTCACATCGACTGCGTATTGCTCTGCGAGTAGCCGCACGA
CGTCCAGGTGACCCCCTCTAGCAGCCTCACGAAGCGCCTCCTCTCTTGCGAACTCCGATACTTGCCGAGCCAGCTCCTGGACCTTCACGAGGTCCCCCGC
CTCTGCAGCTCTTGTGAACTCCCAGCCCTCCATGGACGTTCCGCTTGGTTTTGCTGGTTCGCCCGCGTCAGAAGGGAGAGTGGACGGCCTCTTGACTCAG
TTCCCGTGACTTGCTCAATGGGTACATAGTCGATAAGTCAACACATTCAATACCCGCACAAGCACCCTCGCATCTAGCAGGTTAAGATCAGCTCTACAAA
GGGGAGAAACCCCCAGCCAGCCGGCGTGTAGTGCTGTGGCTGGATCGTACCCTCAAACTACGTGTCAAGAGTGATGGTCTCACTTCAACTTTGGGTTTGC
ACATGCTGGACGGATTCGATCCTTCAGACGAATGAACAAATTTGTCGATCTGGCCCTGCTCGGAAAAATGATGATCCGTTCTTCGCAGGCCAGTGGATGC
ATCAGTGATATCAAGCGCTGCAGTTTGGTTAACAGTAACTAGTCTTCAACTACTGTAGTCGTAGTCATTCATGCTCATGCTTGCCTCCGTGGAGTATTCG
CCTTGCAACACGTCCAAGAAAGAGCTTGAAATCTGCCAGTATAAGAATAAAAAGTGATTAGACCATAGGTTACGACGACAACGTCGTAATTGAACGCACA
TTAAATGTCCTTGCCGTCGCGAAGAATCGTCCGAGGTCATTATCGCTCTGAAACAGCATGCACCGTTGTTAAAAGAAACCTACAGTCAAACGAAGCAAAT
TCACACTACCTTGTGCCGATGAAACCAGGTGACTTTCGCGAGGTAGGCAAAGATGTCCCCCGACGTTGACCGGCGTAACAGTGCAGCCTGCTCACATTGA
GTTCAAAGTCGCTGTGTGAGTAGGTGAGCAAACACTTCAATTCATACGGCACATTAACCTCGATGGTGCTCAAGATGGCTAAACACGTCTGGAAAAACAC
CTTCCAGCCAAACTCGAAAAACAGATCGAGGAACGCGATGACGTAGCGGTGGGGAAACAGCCGACATTCGGTGAATAACGTAAGGATCCAGCTGCGCACA
AAGAAAGGTTGCTCGTCATGACAAACCATTAATGTAGCTTTCGAAAGATCGGCATGCTCACCAAGATGCGTAGGTTGACGGGTGGATATCCCGGTCTGAC
AGGTGGGCATGAAGCCTTGGAAGATGCAACCGCAGAGCCTCGTCGAGCTGGAAAT