Description :
From Genome Similarity Track
Location :
Scaffold_241:7178- 8583
Sequence
1405 bases(100 bases per row)
TCAACAATTATGCATTTTAAACGACGACTATTTACCCTATCCCTAAAAGAATGACCCAGCCGAACAAAAATGAAGCCAGCCGTTTAGCATTTTTCATTTA
CTAAATACGCACCATACACCACACCTATACCACACCACTGATCGGCTTGTATGACATGAATCGCGCCACCAGACATCTGAACGACCATTATAGCACGACA
ATCTGCATTTGTCGTACAAATGGTATGTATTTTGCCAAGCAAACCCTTTTTAGCAGGCAATAGACGACTGAAGCTTTATGCATTCCTTAAGGATATATTG
ACGACCACGGCGCATTCGTTACTACACGTCGGATACATCTAGGTTGCAATTTGTATTTTAGAAATGGCAATAGCCAGGATTCAGTCGGGAAAGATACAAA
AATGAATGAAAATAAGGTTCAATTTATTCTTAACATAATCGGATACATCCGTCGCAACAAAAATACCTCTTAGAACAAGAAATTGTACAATACATATTTA
TATATTTTTGATTGAACCAAACCTGGATCTGCGTTAGGACCTGGCCATTGCCCGTCAACGAAAGCTTGGATAATAAAAGGAAAAGTAAAAGAAAGCCACA
TTTAATCACAAAAATAAAAAGGCAGTCGCTGTGGCCACAGACACTGATACTACGGCCACAGAGATTAATACTTCGGCCACAGAAAATTGACCAGCCAATC
ACAGCTCAGAAAATTCAATTGTAACTACGCACTTCAGCCAATCAAATCTCCTATTTAATTGTACACACGAGCTTCTGCTTCTTATGCGTGTCATATTAAT
CTTGTTCTAGCGTAATTACGATTCTGTTTTATGAGTTCCAACTGCTATCTATGTATGGTATAGAGATTACTATACGGATCTGGATTTTAGAACGGTGGTT
GCTGTTGATTAGGATCCTAAACAAGGTGACGTTCCAATGCCGCGAGAGGTTGACTTCGACCCTAAACGTTATCCGAACATGTTGCAAATTAACGTCGGTG
TCCCGTTTAATGACAAGCACTGCACGTTGGTGCCTTCCTCTTCCTTGATAATATCCTTTTACGTATCAAAGTGACAAGGATCTCGTCGTGTTGAAGTGTC
GGTGCTTGTTCCGCTTGGTCTTCCTTTCGTTCGAGCAACCTCCGGTTCTTCAAGGACTTGTGGTGTTTGATAGTATAAATGGCGTTGGTATCTATTGGAT
TGTCAAACGGAAAATAACCACCACAAAAAATACCTGCTATAAATTAGTCAGCTCCTCCACGACTGCCTCTCTCTGAAGTAGAGGCAACTTACTAAAATTG
TCTTGTAATGTTTCGAAAAGGACTCGGGAAAGATCGTCTGGCTGATCTGCAACAAATGGTCGTACTGAAGGGAGTTAAAGTAGGTGCCTATGAACGTCAA
ATCAT