Description :
From Genome Similarity Track
Location :
contig_5:71762- 87350
Transcript NameFunction/comments
g1302.t1hypothetical protein
g1303.t1hypothetical protein F442_19086
g1304.t1hypothetical protein PHYSODRAFT_310097

Sequence
15588 bases(100 bases per row)
CCAGCTAGCCGCCACTACGAAGTGAATACGTCACGCACGGAACGTTTACCAGCGACGACCGCCGCCACCACCGTATCCACCACGGCCACGGCCTCCACCA
CCACCGCCGCGACCCACAAGGTCACGCAGTTCACGCGGCACCTCCTGTTCAGCCTCCTCCATGATCTTCACCAAAGGTCCAGCCAGTCGACCATTGTTAC
CGGGCGTGAAGAACGAGATCGACGTACCCTTGTTACCGGCACGAGCCGTACGACCGATACGGTGAATATAGTCCTCAATGTTCTTGGGCATATCGAAGTT
GACCACGAAGCGGATGTCCTTGATATCCAGACCACGAGACGCCACATCGGTAGCGACCAGGATCTGAGTCTTGCCGTCCTTGAACTCACGCAGCACGTAG
TCACGCTCCTCCTGCGATTTGTTACCGTGAATGGCCTTGCACATGTAGCGAGTGTCACGCAAGTTGCGGCTCAGCTCATCGGCTCCACGCTTCGTCTCAC
AGAAAATAATGATACGTCCTCCCTCGTAAATGTCGCGCAGGTGGTCCTGTAGCGCAGTGTACTTCTGGTGGTCGTCCATAACCTCAACGATCTGCTTGAT
TTTCTTGTTAGCGGTCAGTTCAAGAGAGCCCACCGTCACTTGAATGAAGTCCGTCAGGAAGTCGTTCGCAAGCGACACAATCTCCTTAGGCCACGTAGCC
GACCACATCAACGTCTGACGGTCGGGGCGGATCTGGCTCACGATCTTGCGCAGCTGCGGCTCAAATCCCATATCGAGCATGCGATCAGCCTCGTCAAGAA
CCAAGTAGGTTACACGGCGCAAGTTCGTCTTGCCCATGCTCAGCATATCAATCATACGACCAGGCGTGCAAATGCAGATCTCCACGCCGCGACGCAGGTC
CGCGATTTGGCCACCCTTGGGGACACCACCGTACACACACGTATTCTTGATCTTGGAGCTAGCGCCAAACTTGTTACATTCCGCCTGAATTTGCACAGCG
AGCTCGCGGGTCGGAGCGATGATCAGAACAATCGGACCGTCGCCAGGTTGCAGGTACGGCTACAGCATAAAATAAAAGCACAAAAAGTTAGGAACCACTT
AGATGCAATCGAGCATATGAAGTTGCACGAGAAAGCAAACACAAGCGAGCGCCGAGGGATTGAGGTGTTCGCGTGCTGCTCTTTCTTCTGGCCACCGCCG
ACAACGCACCAATGCATGTTTCGCACCGATTGATCGCCGAGAAGACGCCGGTGGTCGTCGAGAAAGCAGCCAAGATTTGCTATCTGTATGCGTGTCGATC
GTGCCGAGCCAAACAGCCGAAGCCGTCGTAGAAACTCTCTCCGTCAAATGTTCGACCGGCACTCCAACACAGCAAATCACGCTTCGAATCAACTGAAGTG
ACGAAAAACACGCGAATGCCGCTTACTCTAGGATCGCACAATAGCTCTCCACTAAACGAGCATCCGTGTGGATCGACCACGCTCTGAAGACCGTATCCAA
ACCCCAACGCCTCACGCGTGTGACTCGCTCATCGCATCATATGCGCGAACGATCGTCGTGTGCTTGACACAACGTTGCTAACTCCTCCATCAGCGCACCA
GCGCCACGGAAGATGCGTCCAACAACGACCAAAAGCCTCTACAAAGAGTCTGCTTCAAACTACGAACCTGTGCGTTAATGTGCACGATCGCGGGCAGCAA
GAAAGCCAGCGTTTTGCCGGATCCTGTCGCCGAAATGCCCACCATATCGCGTCCTGAAAGCGCCATCGGCCAGCCCTGGCACTGAATGGCCGTGGGCTTG
TCAAAGCCCAGACGCACCACCTCCTCCAGCACGTACTCGGGGAACGAAGCCTCTTCGAACGACAGTACGCACTTGGGCACGCCCTTGCCAGACACGATAA
TCTGGTTCTCACGCTTCCACTGATCGTACTGATCCTCAGAGCGCTTGGTTACGTCCGGATGCTCGTAGTAAAAGTTTTTCTCGAACACCGGCAGCTTCGA
CATGTCCCACTGGATGTGCGTGTCCAGATTGGAGCCGAGGTCACCGCCGCCTCCACCGAAACCGCCACCTCCCCCACGGCCGCCGCCGCCACCGTATCCA
CCGCCGCCACCGCCTCCGTAGCCACCGCCACCTCCATAGCCTCCGCCGCCACCTCCACCACGAGAGTAGCCGCCGCCGCCACCACCGCCGCCGTAGCCAC
CACTGCTGCCTCCGCCGTAGTCACGACGCGAAGGAAGAGTCGCCGTATCGGTCACCGCCGCCGCCGTACATGATCAAGAGTGATGGTTTGCCGCTTTCAC
TTGCGCGCCACGGGTCGTTTCGACGAATGGGCTGAGTGCGCACTGGGGCGACAGGGGGCAGAGAGCGATCGCTTTGGGCAGGGGAACGGTAACAGGCGGC
TTTTGGTTGGCTGACGGGGGCGGCTTTTCCTGCAATCAGGTGTCGCAGCTCGCGCCATTCGTGGAAAATTCGCATAACCGGCCGTGATTGGACGAAACAA
AACGTTTTTTTTTAAAACGATCTTGATGGCTCAAGATTCTTGAGCCATCAAAAGACAAGACCGCACGAAGATGATGGAGAGCGCATGAGCCCGTTGTATT
GTGCGTTGCAGTAAGCGCAGAAGACGGTGGGGCGGGGTCCTTGCCTCGGTCCGAAGGGTTTACTGGGATGATTTCGCACCCAAAAGTGCGTTCTAAGCCG
CCTACGCTAAGATGGTGCGCTCGTACGAGGCGAACTGCTGGTTGGCCTCCGAGATGCTCACCTCGAGCTTCCGAACTCCACGCTCCTGCAGATTCGGTAG
TTCAATACATTAAAGGGTCAGTAGGCAAGCTGGAGTAGGCAACAGATAGTGGCATAAACATACCAGGAGCGCAACCAGCGTGAATGCGTCCACGAGCTGG
TTGCTCTGTTCCAGGCAGCAGAGAGATAATTGTGAGATATAGACTTCCGCGTAGGATTTCAAACAGCAACCGCACGTACGATGTAAATGGCAAGCTCCTC
CGCCGAAGAGTGCACAATCGGCAGCAACGAACAATCAGCTTTCGGGAAGCTGGACACATGCACAACACTGTTTGTTAGATCCGCTGCCTCTACGCCAGAC
GCCAAATAATCGGCCACCAACCTAAACTTAGCATTATCTTCCGTCAGAATGTGTACGTTCGTGCCATCAAACGAAATCTGCGTGACACCACACTCAAGTC
AGCAATCGGCGCACATCCATTATCCCAACAAAATCACTCCCTCACGTTCAACGCGTCACTGTTCATGGGCACGAGGAACGATTCGTTCAGGTCCTTGCAG
ATCACCGCGAGATCTTCTTGATCTCACCAAAATCCAGGACGTAGCCGTCGCGGCCAACCTGTCCGGTAATCGTGACAGCCAAACGGTAGTTGTGTCCATG
GAGTTTCTCACGGAATCCCTAAAATACGCACGCAGTAACCAAACATCAGATACTCAACCCTGCTTGGAACTGTACCAATCATGCTGCAGCCGTACCTTGT
AAGCGATGAAGTGCGCCGCATTGAACTTCATGTAGTCCTTCGACACGTGTACCTTGAACACTTCGTTGTAGCCGTTGCCCATCGGGTTGGGTGTAGACAA
ATGAGTCGGCATCGCAGCTACCACAGTCGCACCCGTCTTCTGCAACGTTCGGGCGGGCATCGAGGCGTCACTGCTCAACGCAGGAGGCGAGGTCGCACTG
CTTCGGAGCGGCTGGATCTGCGCCTTGATTTCCTCTGGAGTCTTGACGCAGCTACGAAGATGGGACGCCCAGCGGTCAACGTTGCGGGATGAGATTTCCT
TGTCGCAGTAGCAGCACTTGACGATGCCCTCAGAAGTGCCACGCGCCACGTACATTTTGGCGATAGCCTTCTGCTCCGCGTTGAGTTCCTTGCCCATGTC
TGTCGAGTTGTGCTTGCGTCTCTTGGTGGTTCCGGTCCCGGGTAGCTCCTCGATCGACGGGGTAGCGAGGCTCTGCTCTGCGATCCGCTTGAGCTCCTCG
TCGTCAACTGACATCCTCAGGCGGGGAAGCACTGGACGCTCGGTTTGAAAATCAACGAGGCTTTTGATTGGTGGATAAATGTCATATGGTGTCTGTCACA
CTATTTCAATGTGAAACTTTCAACAGTGGCGGAATTTTGATGGCCATGGTAAAAGAAAATGACAAAGTTGAGGCGAATATATATATAGCGTGCCAGCAAC
TCGCCAGTGCGGTCGTGCAGGCTTTGCGGCATGCTGGCGAAGGCGCTCTATTGGTCCGAGACCGCACGCGGCACAACGCTCAAGAAGAAGTTCATGCTCA
CGCCTAGCAGCAATCCGACCTTCTGCTTGCGAGGGACGGAGCGGTCAAGAAGCTGGTACAGGGCACACACAGCTCATGTTAGTCACCGCGTAAATCAAAG
AACGGCAGCGAACGGAACTCACCATCAGCAGCATAAATACACCAAGCAGGAGGCCCATCAAGAACCCCCACAGAAATTCAGTGCCGGTGCCTTCATTATC
TGCTGCCAAAATGGAGTTGTTCATGCCGTTCATGTCGATCTGCGTATCCATCGCAATGCGAGCCGTCGGTACACAACAAGAAAGTAAGTCGATCTAGCCA
AAATAAACCGTTGCAAAGTTCAAGAGAAGCTCATACCGAACTCCGACTGAGGTCCTTGTGACGCCATCCACTCCTCTTCCAGACGATATATCCGGTCCTC
GCTACTCTCGCCAGGGACGCGGTCCGCCTGGCTGATATACACCGAGAGCTGAGGGTAGAAATACAGACGCAACGCCTGGATTTCCTCCCGACTGAGCCGG
TCACGGAGTCTGTCAAAGCCTCTCCGACCGGACGGGTCGTCTCTCTCCTCTGGTTCGCTATCAGTGGCTGCTACCTGCAACATGGTTACGCAATGTCTCG
TTAGCAGTGTGTCCACCAAAATGGACAACCGTCTCTCCACATCCTCGCACCTGGTTCACCACAGCTTTTGGGGGCGCCGAGCTGATGGCGCAGTGTACAA
AGTCTTCGTTCTTGACCTTGCAGCTCTCGAGTGACGCCTTGTCGTCTTGCCCTGGTGGATCAGCCGCAGAAATTTGCCCTCAGCATTGGCTTTCTTCTTC
ACGAGCTCCTTCAGGTCGCCGACGCTTGCGGAGGGCGCGATCTCCACGCGCAGCGGCTTCTCGCTCAGCGTCTTGACCTTCAGCACGATGGTCCCGTTGT
TGTCTTCATGGATCATGATGCCCACGGCGTCATCGGACAACTAGAATAAAATAAAGAAGATAAGTTCAAATAAAATCGGAAGCAGCATGGCACAGCCTCT
CAGCTACGAGTGTGTACCAGCGGCTTCTCCTCCGTGATGTTCTCGGTGAACTCCGGCTCCATCATGCTGCCTGGATCGACCTGTAGGCGCTCACACGCCT
CCCTCGACCGCTCAGCGTCCTCCGCACTATTTGATCTGTGCGGTTTTTCTCGCCAGGGCTTTTTTATCAGCTGCGGGTAGGGATGTGCGAGCCAGTTGGA
TCTCTCCACTTCTACTGGCCAAAATGGACCTCTGTGTTTTAGCCAATCCACGACGTTACCGCGAGAATGAACGCCAATTCAAAATTTGTCCGTGGCTGAA
GCAATGCCCTCCAAGGTGCAAGACGCGGCGGGTTCCGAGAGCTCCCCCAAGCCCCTGTGACAGCTGAATCTGGAGCCAAGAGCGAAGCCGTGCAGGTGGC
CGTGCGTGTGCGGCCGCTGAGCGCTAATGAGGCGTCACAGGGGTCGGAAACGTGTTTGGACGTGGTTAATGGCAGTATCTTACTGGCTGAAAAGCAGTTT
GACTTCGATGTTACATTTCCAGCGACGTCAGATCAGGTCCAGATGAAGGCTTTGGTGGCTAGTTTTTTGTGTCCGTTGTTCTAATGCTTGGTGTTGTATT
TGCTGTAGGAGAGCGTGTACACGACATTGGTAGCGCCTATGGTGGACCAGTTCTTCGCTGGCTTACAATGCCACAGTGCTCGCCTACGGGCAGACGGGAA
CGGGCAAGACGTGAGTGTTGGCGGTAGTCGGATGGTGTGATGTGAGTGTACTGATAGTTTTGTATGTTGAATAGATACACTATGGGCAACGAGTTCGCGT
CTAGCGTGGTTCCCGTGGAGCGCGGCGTCATCCTGCGTGTGGTTCAAGATGTGGGTGAAGAAATCATTCACGCAATGAGTAGGATGGTGTTAATGTCAAC
AACTCATGCGCTTGCAGGTTTTTGAGCGCGTTGAGGCTTCCGCGAATCCTCAACACTTCGTAATCAGGCTGTCATATTTAGAGGTGTGTCGCGTGCTCCG
TTTTTCTCTGTAATGGATCCATGTTGTTCTAATGATAATCTGGGATGTAGATTTTAAACGAGGAAATCCATGATTTGCTGAATGTAGCAAAACCTGAACC
AAACCCACCTCCGAAGAGTACGGGTCTATCTGTACGCGGTGATAGTGACCGTGGGATTGTTGTTTCGGGGCTCAGTGAGCATGTCGTGAACACGATGGAT
CAAGCTGAAGAAATTTTGCGTTCTGGCGCGTTAGTTCGTGCCACAGCTTCTACTACCATGAACGCTAGATCCAGTCGCTCACATGCAATTTGTACTTTCG
TAATGGAGCAGTATGGAGTCAGCGCATCGGGAGGAGGAACGGAAACACGGCTTTCGAAGTTCCATTTGGTTGATTTGGCTGGCTCTGAGCGGGTCCGTCG
CACAAACTCAGAAGGTGCCCGTTTTAGGGAAGGCGTCAACATTAATCGCGGGTTGCTTGCGCTCGGAAACGTTATCAACGCGCTATGCGAGCGCAACCGC
ACAAGTTCGCTAACAGCTCATGTGCCATACCGGGATTCCAAGTTGACTCGACTACTCCAAGACAGTCTGGGTGGTAACAGCAAGACACTGATGATTGCTT
GTATCAGTCCTGCAGATGTAAACTATGAAGAGACTTTCAACACACTCCGGTATGCGTCGCGAACGCGGGAAATTGAGAACAAGGCCGTGATTAACAAGGA
GCGGGGACCTGAGAATGAAGTGGTATATCTCAAACAGCAGCTGGAAATTGTGCGACTGCAGCTGTTACAGCAAACACAAAGTGCGTCAAGCAGGCCTGGC
CGACTTACTCCCCAGGGCTTCAGTGCGGCTAATGGCATTGTGGAGAGCACGTCGGGCGTTAGTGCTCTCGAGGCAGAAAACCGCAAGCTGAAGGCGGAGT
TATCGCTGGCCAACAATGAAAAGAAGAAGTGGAAACAGATTGCGAATGAATTGACGGACAAGAACAAGAACGAGTCAGAGTTTGCACCAAGCAAGGCTAT
CGGTAGTCATCTGGATGTGTCGGCACCCATCAAGAAGCATGGTGCGGTTAACGATGGAGAATATGGCAAAAGTGGGCCTCTGTCACGGCTGGAGCAACTT
CGGAAGTTCCAAAGCCATAAAGTGAAGTCACAGCACAGCAAAGATGACACAGCTGTGAAGCGAAAGAATGGGGACTATACCCCGGCAAACATGCACACTC
GGACGTTGATGTCACCATCCACCAGCACTCCGGACACTGAAAGCAAAATTTTGAATGCAAGGATGGCTTTAGTACTCCCTTCCCATATCAAGAGAAGCAG
GGTCGGTGAATCTGCTGCTCTTATAATGGGGACAATTACGAAGCTTTTACAGCAGGTGCTAGCGTCCCAAGAATCGATTTACAATGCAAAAGTGGATGTC
CGAGTGAATCTTGCAAACAGAAATGCTCTGGCGCTGGAGATTTCGCAACTCGAGGGGTCATCCTCAACAGAAAACACTGAGAGGCTGGCCAGGTTACGAA
GTGATCTCCGAAGTAAGTCTGCTAATATTCGGCTTCTCCAACAAAAGTTGGCGAATGTCGGAAAAAACGTGTCGCTGCCGTCGGGACTTTTTCCCATCAG
GTTGGAAACCTGCCATGACTTGATCCGGCATCTCATTGAAACGTTAGTAGGATTCAAAGAGGAGTGTATGGTCCTCCAGTCGGATGCAGCCAATGAAAGG
ATTATGAGTCAGCAAGAAGCGCATAGCAAAGTCCAGGCACTGGGTAAGAGATTGAAAGAGGCATTGAAGGAGATGCAAACTCTACGGGAGCAATCAACGA
AGAAAAAGGCAGCCAAGAAACGAAAAGCTCGAGAGTCGTACGAAACGATGGATACGCTGTTCAGCAGCAGCAGCGAAGAGGAAGACAATACTGAAGCTGA
CTCGGACTATGTGGATGAGGAAGTCAATCGGAATGAAGGCAACAAGAGGAAGAGACGTTGCCGTACGCCTGTGTCGGAAGGGTCCAAGAGAGTAGATGCT
ATGGACGAAATCGATGAACTGCTAGAGACCAGTGCAGCCACCTGTTGCGCGTGTTACGGCAAATGTGCAACGAAGGCGTGCGCTTGCAAGTCGCAAAATC
GCATCTGCAACAACGAATGCTCGTGCAACTCAAACAAATGCCAGAATCGAGGGGGCGATGACAACACTGGCGAGTCTTCAGGTGTCGTCCATGACAGCGA
CGAAGTTCTTGGTATGACCGTCAGTGATGTAGCTCGTTCAACTCCAAAGCGTGGTGCAGGTGATTTTGCCTCGGAAACGAGCAGCTCGACGACTTTGATG
AACCCCACGGTGACGACATATACAAGCCCCATTATTGACTTAATGTCACCGTGAGCACGCATTTCGGATCCTGCTGTTCAAAAACATTGGCGAAACGAGA
AGCAATACGCTAGAAACGAAGCAACAGACACATCACCATACTAAATGGAACATGTACGTGAGGTCAGGTAAATTCGTGTATTATTCGTTCGAGGTGAACT
CCTTGTGCGTGTCGGCCATTCACCACCGCCGCCTCGCTCAATAAGAGCGACACACAATCTACACCGTTAAGCTTGCTCTCATGATAGGTCCCCAAAGAGA
TCCATGTCTAGTGCTTCAGGTTTTCCCGCCATGTATTCGGTATCGTCCTCATCATCGGTGTCAGAGGAGGCATGATGGCGAGCAGCCACCTTTTCACCTC
GACGAGTCGGCGTGCGGATGCTCACGCCGTTCGAGTTCTTACCGTTGCTGCTTCCAATGCTGCCTGTACCCTTGTTCTCACTCGTCCTTGACCTCGTGCG
GATAACAAGTGCAGCCTCCTTGGGCTTCTGATACTGGTATGTGTTGTTGCCGCTTGAAGTCGAAGAGTATTTTGCGCGCAACGCGCGAGCCTTCTCCTCA
CTCTTCTTCGCCAAAATTCTGAATGAGTTGGCGCTCATGGTTACTCATGTACGACATCTGCACGTCCGCATCGAGCACCAGGAAAAGTTCCTGGTATTCG
ACCTCCTTCTGTGCAAATGATGCAGCGGGCACGAATTCGTAGGAAACCACTTCGAGTATATCGATTGAGTCACGATGGTACGGGATACGTGCGAAGCGCA
ACCGCTCAGCGGGAATTGACAGCGCAGCGCTAGCAGCGTCCGCCAAGCACGTCTCGGGATGGTTTTCCTCGTCTGAGGTTGAAATCACCACCTCATGCCG
CATGTTCTTGACGAAGCGCCACGTCCCGCGGTTCACATACGCAAATTCAACGATTCGGTGGTTGACTTCTGTGGTCTCTGGCTCTGACAACAGTTCTGCA
ACAATGCTTCTTCCTTCGTACACCGCAAGTTTTGATGCCTCCACGAGTTTTTGACCATCCACCAGCACGCTTGTCATTGTGCTTTGACGTAGATCGCGAA
GGCGGACGTGGGATGGAGTCAAATTACCGCCATTTGCATTTATCAAGTCCTTCTGCACTAGTCCATTCCAGACCTTCTGACGAATATCTTCCACGAGCAT
CTCCTCACTAATCACGATTTGGTCCACAAATGTCAGCAATGAATCATCCTTTCCTGTCGCCACCAGCACCTCATCAATATCAAAGAAATCGTGGCTGTTG
CTGTCATCTGCTGATGTCACGGTAGGTTGACCCTGGTTGTTGTCCTCACCCTCGGGTGAAACGGAACTACCGTTGGACGGATTGTAGAACATCAATCGAA
AGTTGTACTCCCCCGTGTTCAGCGGGGTGCCCTCCAAAGCGAAGACCGTGTGGTTGGAGCCGATTGACAGCTTGGATAGAGTACTATCGATAGCCTTGAT
TTCTACACCAGCACTGTTGATGCCACGTAACAGCTTGAATTTGTTCGAGGGCAGGCCAATCTTAGCACTAATTCGCTCCTTTAGCGCACGGATCGTCTCC
CGCCTGTCAATGCGAATGGGCTCGGCAGGGCTCGTCAAGTACTTAAAGTTTACGGTAATCATGTTGGCCTCACGCTCAAAGAACGCCTCAGCAGGGGACG
CAAGCGTAAGATCTGGTGTCTCCTCGAGGTACAACTCCGTCCCATTCACCAAGTGCAGATCCATCTTTAGTCGCAGGTTCCGTGTGCGCTCTTCATCGTT
TGCATTCAGAATCTTGGCTGCAGAAATGCTGTATGTGGTTGCGCTCTTCTTGATGAGGCGAATCTTCTGTTCAGCTGGGACGGAGAACTTTTTGGCGATC
AGAGCACAGAGAGAGACTATGTTTGCACCCTCGTCCACCTGAATGCACCTTGCCATGAACGAGCTCTGGAAGGTGTTGCTGGTGCTGCTTGTAGGCTCAG
ATTCTGGATCAACAAAGCGACGAATAAAGAGCTGGAGCTTTGTTGGATCATGATCTTCCCATTCTTCGTCATCGTTCTTAACCTCGAGGAACATCTGCTG
TCCGGCATAGATACCCAATGATGATAACGTCATGTCCTCTTTATCGTTGTACGTGTCAGATAGCAGGCAGTTATAGTCGTTGTATCCTCGCAATCTCACG
TTTTCTATCGAAGGTACAACCACGTCCTTCTCGATCGCAAACTCCTTGTACGCTGTTTCAAGTGCCTCGCGAATAGTCGAGGTCTTGTAGACGTAGATGG
CCTTCTCTATGTTTTTAGGCCTGGAACCCTTCATAAAAAACTTCACTTGCACCTTCTTCGCCATCTCAATCCGCTCCTGCTCAAGTTTGCGAATCTTGTC
TTCATCAGCGTGAATCTTGTCTTTCAAATATTGTGGAATACTATCCGGCAAAATTACATTTACGTTCTTCTCTGCAGAAACCAAGCGATACAACAGCATG
TACGCACACGTGCTGTAGCGCATGCTGTAACCAGAACCACTAGCGCCTCCAAATGCAGTCTTAAGCTCTGTGTCTGAGATCTCACTCACATTGGAGTCAT
TGAAGTTGTACCACTTGCCCGTCTCCAGGGATTTAATGTACGCGTAGTAGTGCCCACCCAGCGCGCTGCCAGAGTGAATGAGCACCGAGTACAGCTCATA
CACATGCGGCCCTGAGCGCTTAATCATGACCTCAGGGTCAAATATGGAGCTCCACGTGTCAAACGAAGCAGCACCTTCCACATCGTCTTCCTCCTCCTCC
TCCTCTTTTTCGTCATTATTCACAAACGTCATCGGCTGCGATTCATCCATAGAAGACAGGCGGCGCATACGTTCACCCATAGCAGCAAGTCCAGGCGTTG
GGGAGGAGAAGAAGGTATCGTAGGCACTACATCCTCAGATGATTTAGGGTGGTTCTTGCCCTCCAACACGTGACGCTCCATCGACATTTTTCTAGCAATC
TTACCCCGTACCCCTCCGTTCTCGTCGCTCACGTACGAGTTCATGTCCAGGTACTTGGGAACGTCACCTCGTTGTGTAATTTAATTCGGTTCATCGTAGC
ATAGTCAAAATCAAAACGTTTCAGCTGCAGCATCAAAATGTACGGCAGCTTGGAGAATTTAGTCCCTTAATCGCGTCACGTTTAACCTTGCATCGGTCGC
ACATCCACTGGTTTTCCTTGTCCAGCACCTCCGGGCGCAAAAACAGCTCAATAGCCTCCTCCACAGTCTTCATCATTTCCGTCGATCCAAAAGGTCGGAT
CACAAGCGACAAATCCAAAAAATTATCAATCCTCGAGCTCTCGTATCCACACTCACAGCATTGCACATAATCCTTGAGCGATCCCTGGTACAAATCATTC
ACAAGAGTCTCGTTCACCGTGCCCTTAAAAGACTTCTCCAGTGCGTCCAGCAGCACTCGACAGAGCTCCTGCACATCATGTTGCTGGAACACGTCAGCTC
CTGTCCAGCCAAAGCTCTTAGTCAGAGCCTTGGTAGAAATAGAGTCCTGTGTCGTGAGTTGCAGCTTGGCGAACAGGTTCTGGAGTTGCAACGGGATGTT
GTCTTCGTCGGCCTCTTCGTCGCTGTCCTCGTCTTCTTCTTGCTCGGTCAGCTCCGCTTTCTTGGCTGCATGACGGCACGTCCAGTTGTACAGGCCCTGA
CGGAACTCGGGCGTCATGAACATGCTCTGCAGAAGACTGTTCATGTAGCACGTGGCTCCCTGGTTGGACAGGCCAGTGAAGGCGTTCCTGGCTCTGCTGT
AACCCCCAGAGCTACCATAGCTGCTTCCACCATTGCTCGTGTAGCCCGGCGAGTCGTAGAGTCCCTCCAGCCCCGAAGAACTGTACGTCGTGAGCGCCGT
GGACTGCACGCTGGGACTCGCCGCACTGTCCGCGTCGTCGTCGGCGCGCGGCAGCTGCGTCAGCACGGAGGCCACCTGCGCACGGTGTTGCTCGCGAGAT
GTCGAGGCCTCGTCGTCGTCGCTCGAGTCCCAGCTCATGCCAGAAACTCTCGGGGATCTCCAGGTCGCCAGTCGCTCATGCTCAAAGGATTTTCGCTATT
ACGACTGAGATCTGGTGTGAGGGAGGATGTGGTGTATGTAACACAACATATAAGTACCGTGGATAGAGTGACAGAAAGTGCCTGTTCGTCGACCACCGGA
AGAAGGCTGAGACGTGTGGTGCTTTTGGCACTGGAATTGATGTTTGAGTTGAGTATGCCTGAGCCTGGAGGAGTTAGCGTGATGATAATGGTCGGTGGTT
GGAAAGATAAGAATGTGCTGACGAGACAAAAATGAAAACGAGGAGCGAGGGTGAGCTCAACAGAATACAGCAGTGACTATGCAAACAGTTTCCAGTCTTA
GATATCATCGCTTGTCTGACGTCGACGAGGTCCCAAGACTTACACCATGCGTGGCGTGGGGGATCTGTTCTTCGCCAACGGCAGCTCCTCATCCGAGTCT
TCCGAACCGTAGTTGGCTCTGTCGCGCTTGAGCGTGAACGTGTCGGTGAGGAAGTCCAACTCGCCCGCGCGCAGCTTCTCTTTCCGCCACATCGTGTAGC
ACACGCCCATTGCAACGGCGTACAGCATGGCTAAGCAGCAGCGAGAAAAATAATTCATCCAACCACACCGACAGTAGCACAAACGCACCCCGACAGTCAA
TACGTCACACAAATAAGTCTCCACACACGACCAACACCCAATTAAAATTGAAGGCAATTCCTACCGGCCTCAAAGCACGAGTTGGCCCCCGAGTTGGGTG
TCTTGGCGTTGTGAATGTACATCGGCTGCAGCTTCAGCAAAGAACCGACCACTACCTGCAAATTCAGCACAATGTGGAGTCACCAGCAGAGTTAGAAACA
GCCAGAACATCGCAGCAGAGCGCTCTGCGACCAGCGAAAGCGACATGGCCGTGTACCAGGAAGACGAAGCCCATGAAGCTGAAGATGGTGCCGCACAAAT
AACCTGCAGCGGGCGCAACAGACATCGCCAGATAGAGCAGACGCAGGTTAATCAACCGGGTAGCGAGAACACCGCGACTGAGGACACGTACCCCCTCCAC
TCATGCTGCCGTCTGATACTCCGCTTCTTCCTCTTGCGAATTGTCGATCCAGCTGCCGTCTCCGCCCCTAGGCATTTCATCCAATGGGAGGATCACAAGA
TGGATACGCGGCTCTGAACCACTTTAGTGTGTCGAAACACCAAATAACGTGTTGCACACAATATTCTAACTTGAAGTTTACGTAAAATAAAGCAGGTCAT
CGCTCAATGCTGCATCATTGCCTGCTTCACTGTCATGGGCGTCGCCAAGAAGCTGCGCGTGCTGTGCATGCATGGGTACCGCACCAACGCCAAGATCATG
GAGGACCAGGCGCGCGGACTGCGCAAGGCTCTGGCGCCGCACGCCGAGTTCGTGTTTCTGAACGGGCCCATCGAAGCCCGCGGACCCTCGGACGACGTCA
TCGAGACGCGATACGCCGAGCACAAGCCATTCTACGAATGGGGGAGCTTCATCGAGCGCAAGCGACCGCAGGAGTGCGACCCGGAGACGCAGGAGCTCGT
GTACACCGACCAGGGCTGGTACCACGACTACGTGGACTGGGACGCCACGGTGCAGTACATGGACGAGCAGCTACCGAAGCTCGGGCCCATCGACGCCGTC
GTGGGCTTCTCCCAGGGCGCACAGACTATGACGGCGCTGACGATGTGGTACCTGCACAATCACAACAAGCGCTGGTGGAAATGTTGTGTGAGCGTCTGCG
GCCCAAGGGTGCGTGGGGCTGCGCTCCGTCCGCTATTTGAGAATGAGGATGGGAGTCCTCGGTTGGTGCCCATGCCCTCGATCCACATCGTCGGGAAGAC
GGACAAGTGGCATCGAGGCTGCCACGAGATGGTGGACATGTACGAGGACCACCCGGACGGAGCAGCACGCGACAAATTCGTGTTCGAACACGACACGGGC
CACCGCTTCCCTTCCGGAAAGAGACACGACCAGCTCTACGAGGACGTGGCTCAGATCATCCTGCAGCATTGCCAGTGAAGCAATAGAGGTGGGTCTGGAG
GGTAAAAAGTAAATGCCAATGAACTATAGCTTTGCCCGAGCATTGTTGAAGATGCCGTAGATCGACTCATCAGCATTGAAGATAGTGGTCCGAACGTCAG
GAGACTTCACATCTAGATTTGCGGCCGAAGCAGCTCGAGGACTTCTGAGAGAGCTGCGCACGCTCAAACACACGTCCTCGATAATGAGAGTTGCGACGAA
GAAGCTTCGCATTCTGTGCCTTCACGGCTACCGGACCAACGTGAAGGTGATGCAGGATCAGACGCGGGCTCTGCGTCATGTCATGGCCCCCCACGCGGAA
TTTGTGTTTGCCACAGCCCCATTCAAGGCGCGCGGTGCCTCGGACGAGACGATTGAGCGGCTTTACAAGGACCATGCGCCGTTTTACGAGTGGGGCCACA
TCACCAGGTTGGATCGCCAGTCAGACACGAGCGACAACGGATGGTACCATCAATACGTCGGGTTCGACCGGGTCGTGGAGCACATCGACAAACAGGTGCA
AGACCACGGCCCTTTCGACGCCGCCATCGGCTTTTCGCAGGGTGGCCAAATACTCACTGCGTTGTCGATGTGGTACCTGCACCAACGCAACGAACGCCAC
TGGAAGTGCTGTCTCATTTGCTCGGGCACCCGTGTGCGAGACGTAGGTTTGCGTCCTCTCTTTGAACACGCTGACGGTTCGCCCAAGCACGTCCCAATAC
CATCCATTCATCTCATCGGCAAGAAGGACCCGTACTACAACACCTGCCACGAGCACGCCGAGCTGTACGCTGCCAGCCCAAAGTTTGTGTTTGAGCATGA
AAGCGGCCACCGATTCCCGTCTGGTGATCGCCATCCCGAACTCTACGAGAAAATCTCGGATATGATCCGAAAGCACTGCAACAATTGA