Description :
From Genome Similarity Track
Location :
Scaffold_185:7176- 9236
Transcript NameFunction/comments
Albla_Nc14093460myosinlike protein putative

Sequence
2060 bases(100 bases per row)
TTTGCAACAACATCCATACTGTCGAATCACTGCATTGCCTAACCGAATTGGCTCATCTTCACGAGCCATCCATCCTTCACGTGCTACATCAACGGTACCA
GCGGGATAGAATTTACACGTTTCTCGGAGAGATTCTGGTAGCACTGAATCCGTTCAAGACCATTGAGGATCTGTATTCATCTTCTCAACTCGCCTTGTAT
GACCCGAGTCTCCATAGTGATCAGTTATCATCTCGACAACCGCATGTTTTCGCTGTTGGAGGTAGAACATTCGACAGAATGAGAAGGAATCGATGCAATC
AGTCGATACTTGTGAGCGGAGAAAGCGGAGCTGGGAAGACAGAGACTGCCAAATATCTTCTTCATTTCTTCACTGCTACGCAAGAGACATTGGCGTCTGG
GAACGACAATAGCTCAAAGATTGGGAAGTATATACTTCAAACAAATCCGATTTTGGAATCGTTTGGAAATGCACTGACGATTCGCAATGACAATAGCAGT
CGATTTGGAAAGTTTACAACCCTACAATTCGATGCAACGTCACATGTTCTCATCGGAGCTCGAGTCGCATCGTATCTCTTGGAGAAAGTTCGCTTGATTC
ATCAGGCGCAGGATGAACAGAACTTTCACATTTTCTACGAGCTTTATTTCGGAGCGTCCCAAGAGACCAAAAATCGACTTTTGGGTGGACAAAATTCTTT
CCGTTATCTCCCACATCTTACACAATTCACCACATCACAACAAAACGCGTACACGAGTCGATACAAGAACACAATACAAGCTTTGAGCGACATTGGGACG
CTCCAGTCGGAACGAGATGATCTGCTTAGTCTTCTTGGAGCCGTATTGCATCTCGGAAATGTGGAATTCTCAACAACAGATCAGAGACTCGTGGTTTCTG
AATTGTGTGAGGAACACCTTGAGAGAGCTGCCGAATTGCTCGAGTTGCCAGTCGAATCGCTATTGAAGCTGATGAGCACGAAGAAAATCCAGGCAGGTGG
GGAGACGGTGCATTTAGACGTGAGTCCGCATCAAGCGGAAGAAATGTGTCATTCTCTCGGTAAATTCATCTACTGCGGTTTGTTCGAATGGCTTGTTCAG
CGTCTCAACAACACGATCGATGCTGGATCAGCGTCACAAACGCGCAACTCGCTTCTTTGCATTGGAATTCTCGATATCTTTGGTTTCGAAAATGTTCACC
AGAATGGCTTTGAGCAGCTTTGTATCAATTATGCGAATGAAAGGATCCAAGCGCAATTCAATGAGTGCGTTTTCCAAAAGGAACAGCAAATATACAAAGA
GCAAGGAATTCTATGGAAAGAGATTGAATATTCGGACAATCTGAATTGCCTCTCCTTCTTTGACGATCGCGTGCAAGGATTCTTCTCGCTTCTCAACCAG
GAATGCATGCTACCGAAAGGATCCAATGAAGCTCTTATAACCAAACTTTATCGCGCGTACGTGAAGAGAGGATGCAGTAGACTCGATAGCGTCTTGGCGA
ATGTATGCTTTAGCGCTGGGAATATCGAACAAAGCCGATTTCAGTTCGTGATCAAGCACTTTGCCGGTCACGTTCGTTATGAGTTGGATCGGTTTCTGGA
AAAGAATATGGACACACTTCCGCTAAACGCCCAGCAATTATTCATTCAGTCTTCCAACGATATTCTCTCTTTTATCGGATTGAGGGGACGAATGGATGGT
GAGTCCAGTTCCAACACCCTTGGAGACACTGAGAGGCTCTCTTCAAGTCGCCAAGTGTTCACACGCAATTCACTTATCAAGCCGACAAGCGATAAAAGAT
ATCGACGGAATTCGACGGTATGCGTTGCGAGTTTATCGGCACAATTTCGGTCTCAATTGGACTCGCTTTTGTATGAAATCGGTAAAACGGAACCTCATTA
CATTCGTTGTATCAAGACCAACGACTTTAAGGAACCGAATTATTTGGATCGAACTCGCGTGGTCGAGCAATTACGTTGTGCGGGTGTTGTGGAAGCAGCT
CGAATCGCTCGAGCCGGATTCTCCGTTCGAATTTGCTACAAAGAATTCATCCAACAGTTC