Description :
From Genome Similarity Track
Location :
Scaffold_1:717416- 721715
Transcript NameFunction/comments
Phyin_T30-4PITG_00101HECT E3 ubiquitin ligase%2C putative

Sequence
4299 bases(100 bases per row)
TCAAATTCGAAGCTGATCTGTCGGACTGATACCCGTCCAGCCTGTCATTTCCGTGTCAGCAAGACGGAATTCTCCATCCATTTCGACGCAATTGCGCACA
GCATACAAAAGTCGTTCGCGGCAGATTTCGTCGCTGGAATATCGTGGGAGTTGGAGTGCGAAGAAACACGTATGCGACTTCGGCATCTGCGAGTCCATCC
AGCCTCCAGGGGGTCCTGACGATGAGCCGTTCGCGTCTCCATTACCCGAAGACGCAAGCGCTTGGATCTTAAATTTCTGGTGGAACTGTGCTGAGCCCAA
AGGCAAACGAGACCGGGCCCACACAAACCGCAGGAAGGCTCGTTTATCCTCCGCTTCGAGACTTTCCAGCACGCGCCAAAATCTCTGAATAAACTCGTCG
TTCATCGACAAATCTTCGTCGTACTCGGTATTAATCTGCAATAGCTTCACGTCCACTTCCGCAACGCCACACATGCGTTTCTCAAGCTCATTCCACGTCA
GAAGAGCCAATGCAGACACCGGCATAATGGAGTGCAGTCCCTGCTTTACTATATTCACCACCTCTTGCGTTTCTTGGATCCGTGCTCGAAGCATAGAATC
TATATATTCTTGCAGATTTTTCAAAGTCACCGCAGTATTGGAGCCATCTTCACAGATATCAACTGTACGTCCATCGGATAATACAGTCGTAAAGACCAAA
TCCATCGCTTCTAGTCGTTTTTCAAGCCCTTCCTGCTTTGAATTTTGACGTTTAAACTCGTCTAAAATACCTTTCAACGTCTTCCATAATGAATACGCGA
CGAAATCGATCTCTTTGAGCGTTGCTAGCGCACTCTCCGGGTTCGAGTCGTCTTCAGCCACTAGTTGTTTCCACACTGACATTGCCAGATCGAGGCGAAC
GCACACACGCGTGCGTAGACAAATGCCGATCATCTGACCGAGAAAGAAAAACATTTCACAATAAAGTTGTCGTTTCTCTTCAGCGCTTTCTCCAGATAAA
CACGATACCTTCTTATCATGTATTTGACGCTCGATAAGAGCTCCATTAAGTACGAATTTCTCACGGTTGGCTCCAACGCCATTCCGCCAATTCGGACTAG
GCAGAAGGAAGGGCAAGACACACGCTGATACGGATACATTGGGGTCCACTTTCAGCGACGTACTACTGGGTCCTCCATTCGCAGTATACTCCGAACTTGT
GGACCCATTATCTTCGCCTTCGGGTACGTTAAGCATCTGTAACTCGGCGAAGAATTGCGAAAAGAACTCTCGATATGGACCACCATAGTCATCCACTCCT
TCTCCCTCGAACTTAACTTTAAAGCTTCGTAATTGACCGTCATCCATTGGGTGGGAGTAGACCATACGTAGCGTTTTAATAGGTAAGAAATGAAGCTCTT
CAAACGACTGGCCAAAGAGGGATGAGAACAAACTGCTGACTGTTCCTTCGTGACATTTTGCTGCTGCTGCCTTCAGCCGGTTCACGTGTAGCTGCGGTAA
ATCTTCGGGATAATCGTACTCGTCGTCAGATTTTTTGGGTGAATTAGCGGTTTTTTCCATCAACGCTGTCCAAAGTGTTTTTTTTACACAGACAAAGAGA
CTACCGCGACATTGTGACACTAGTCGACACGGCAACGAGTTGGAATCCGGTAAAAAGTAGTGCCATGAGAGGTCGAAAAAGGGTAAAGCGCGACTGATGT
ACATGTTGCAGAAGCGCAGTATTGCGAACCGTGCGACGATCATCTCGTCAGGCTGAGGCATTGCAAGTACGTTACTAAAGGACGAAAGCTCTAGTACCGC
AGTCTTCTCTTTGACAACATTGAGCAGTTGATTGGGTGTCAGATTCCACGGACTAGTGCGAGATACCTCACAGAAATCGTTAATCACACTTAGAAGCTCC
CGATCCACTGCTACAGTCCACAAATAATGTTCCCCATACTCAACGAGTTCTTCTCGAGAAAGAGTAAAGGGCGAAGATATGTCCACTTTTGAACCCAAAT
GTGGGTCATTTAAAGAGTCTGGTGGGATATTTAAGTTGTCAACTGGAGTAGTGGAACTGGGTGTTGTTGCGCTCGCCACTAAGCGTAGTTTGGACGGATG
GAAGAACCACGCTCCAGGTTCATTGTCGACTTCCACCCAGATCCGTCCGCCTGCCACGCCCATTACAACTCCATTCCCACGAGGTGTGCGGACTTTATCA
TCGCAATAAAACCCAGCTTTTTCACATGTTCCTCGCGTAACATCCACCCAGAGGGATTTCCCGGATCGCGTGGTAACGTGTTTAATAGATCCGGCGAGCC
ATTCTGCCGTCATTTCGAACGTAGCAGCAGCCATTTCCACTCGCATGGGTCTTTTATCCACCCAGTTGGCCATCAGCTCACAGGCTATTAAACAGTCCTC
CACACCCGCGTCTTCTAGCTCTCCAGTCGGAGGTATATTAGTCTCACCGGTACAACTATCCTTAACGAAGGAGATCTTCTGATGTCGCGAGTAAAAGGCC
ACAGCGGGGGACACTGAACTCACAATATTATCGAACGCCACACCCAAATCCACTCCATTTTTACTAAACGAAAGCTCGCCTTTCTCGCAATCCAGCCGTA
ACCCAATGCAATCTCCTTCCGTGAATGTCTCGCCGTATGCTCGTATGCGGTTCCGCTGGTAGTACAGTGCTTTATCGCCAATAAAACCCCAGGATTGATC
GTCCGCTCCAAGGAATGAATCCAAGTTCGCTTGTCGAGTAGCGACCCCTACAAAGAGATACGGAGAACTAGACTTTTCAATACGCACCAGCCATGAATGC
ACGCCAGTCGAGAAGCTCGTGACGGCACACGCAGCTTTCCATACCTCATTCCCAGAGTACGACACACTGAGGTTGTCGTCTGCGAAGGATAACAAGCTAC
TGCGAGTGCGTTTGCGGTCAAACAGCAGCAAACAACCTTCCGATTCCAACGCATCTCCACTGCTACTAGCGACCATATGAGCGGCAGGTGTTGGGGCCAC
GTTAAACCCAGTAACGCCCTGTAGAACGTGCAGCAGTTCCACGTACCCCTGGAGATACTGAGAGAATAACAGTCGACCTTGACTCAACTCGCGACTGTGT
CTTACAACAGCTGCAGTTAAGAAGTCTTGGACAACCAGTTGTGCCTCGTTTACCATGTCTTTGTCGACATTTTCTATGGCTCTCAATACTCTGCTGATAG
TGCGAAGGATGACAAACTTCAGCGGCAAATTCGTCGTGCCAAGACAACGTCGTAGACGGCGTAAAATAATCTTCGCAGCATCAACAGAAAGACACAATGA
CGAGTGTGTAGAAGCTGCTAGTAGCGCGTCTAGCAGCCAAATAACAAGTTCAATTCCTGGCTCTTCCAGCACAATTTGATCTGGACGATGGAGCTCCCGT
TGCGTCCATAAAACAGCTTCGTACGCTTTACCAGCTGCTGCTGTTTCCAGTTCTTCAAGGCAGAATTCGAACGCTGACGCAACGAAAGATGCGTCGTGCT
GGATCAAATATCGAATCGACTTTGAAAATACTTCATCAATAGATAATTTTTGCAACTGTGTCGACGAATTTCGCACAATAATTGCGAATTGATCCCCACG
TAATCCAGCAGCTTGAACCACTGTTTAAACGGTATCAAAACCGGTACTGACCTTGTCTGATGTAACACTGTGGCCATAATCTGACGAGCATACAGGATTG
ACAACGTGTTCTCGAATTCTCGCAGCTGGCGGACAAGATCTTGAAGGTCAAGTTGGTTCAATTCTCTCTTCACTTTCGTTTCTATGGCGTCAGCTCGCCA
TGATTTCATAAAACGCGACTTGGTATTCGACAGGAAGCCTGAAAGGAAAATACATTTCCGCAAACAATTTTCTCCCCATTTCTTTGTCATTTAAATGAGG
GACATCCATATCGTTCTCGGCGTCCTTTGTCGTGTTAACAGTCGCACTTAATGACGGAACGTGCGTACTACCGCTCGGTATATCGTCAGTATTCACGACG
TCGTCCTCTTCTTCGTCGAAATGAGGAGAATCTCGTCCCTTATCGCGTTCTTTATCCAATGTGGACTGTAACTTACTCAGATATTCCAGATTGTCCACAA
TCCAAGCCGACGCATTGACGATATCGTTCTCGGTTTGCTTTAACGCCAGCACGCACCAATCTTCCGGAAATCCCATCAGCATCAGCTCCTCCACGAACTC
CGCTCTATTTTCTTCAGCGTCGTCTTCGTCGTCGTCATTGTCTCCATCGTCTAAACTCTCGTCTTCCTCGTCGTCTTCGTCGTCGTCTTGCTCGTCACC